ID: 1061979161

View in Genome Browser
Species Human (GRCh38)
Location 9:134090231-134090253
Sequence ACAAGGTTGTGCATACACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979153_1061979161 9 Left 1061979153 9:134090199-134090221 CCACTCGGCTCCCTGGCCTTGTG No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979148_1061979161 28 Left 1061979148 9:134090180-134090202 CCAATGCCCGGGGGCATAACCAC No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979154_1061979161 -1 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979150_1061979161 22 Left 1061979150 9:134090186-134090208 CCCGGGGGCATAACCACTCGGCT No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979155_1061979161 -2 Left 1061979155 9:134090210-134090232 CCTGGCCTTGTGCCCACATGTAC No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979151_1061979161 21 Left 1061979151 9:134090187-134090209 CCGGGGGCATAACCACTCGGCTC No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data
1061979157_1061979161 -7 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979161 9:134090231-134090253 ACAAGGTTGTGCATACACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979161 Original CRISPR ACAAGGTTGTGCATACACCA GGG Intergenic
No off target data available for this crispr