ID: 1061979162

View in Genome Browser
Species Human (GRCh38)
Location 9:134090243-134090265
Sequence ATACACCAGGGTGTCCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979153_1061979162 21 Left 1061979153 9:134090199-134090221 CCACTCGGCTCCCTGGCCTTGTG No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data
1061979154_1061979162 11 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data
1061979158_1061979162 -2 Left 1061979158 9:134090222-134090244 CCCACATGTACAAGGTTGTGCAT No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data
1061979157_1061979162 5 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data
1061979159_1061979162 -3 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data
1061979155_1061979162 10 Left 1061979155 9:134090210-134090232 CCTGGCCTTGTGCCCACATGTAC No data
Right 1061979162 9:134090243-134090265 ATACACCAGGGTGTCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979162 Original CRISPR ATACACCAGGGTGTCCACAG AGG Intergenic
No off target data available for this crispr