ID: 1061979163

View in Genome Browser
Species Human (GRCh38)
Location 9:134090248-134090270
Sequence CCTGGCCTCTGTGGACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979163_1061979170 -3 Left 1061979163 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
Right 1061979170 9:134090268-134090290 AGGAAGTGGCAGGTTAAGAAGGG No data
1061979163_1061979173 10 Left 1061979163 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
Right 1061979173 9:134090281-134090303 TTAAGAAGGGGGTCAGAAAGTGG No data
1061979163_1061979169 -4 Left 1061979163 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
Right 1061979169 9:134090267-134090289 CAGGAAGTGGCAGGTTAAGAAGG No data
1061979163_1061979171 -2 Left 1061979163 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
Right 1061979171 9:134090269-134090291 GGAAGTGGCAGGTTAAGAAGGGG No data
1061979163_1061979172 -1 Left 1061979163 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
Right 1061979172 9:134090270-134090292 GAAGTGGCAGGTTAAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979163 Original CRISPR CCTGGCCTCTGTGGACACCC TGG (reversed) Intergenic
No off target data available for this crispr