ID: 1061979165

View in Genome Browser
Species Human (GRCh38)
Location 9:134090254-134090276
Sequence TGTCCACAGAGGCCAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979157_1061979165 16 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979165 9:134090254-134090276 TGTCCACAGAGGCCAGGAAGTGG No data
1061979159_1061979165 8 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979165 9:134090254-134090276 TGTCCACAGAGGCCAGGAAGTGG No data
1061979155_1061979165 21 Left 1061979155 9:134090210-134090232 CCTGGCCTTGTGCCCACATGTAC No data
Right 1061979165 9:134090254-134090276 TGTCCACAGAGGCCAGGAAGTGG No data
1061979154_1061979165 22 Left 1061979154 9:134090209-134090231 CCCTGGCCTTGTGCCCACATGTA No data
Right 1061979165 9:134090254-134090276 TGTCCACAGAGGCCAGGAAGTGG No data
1061979158_1061979165 9 Left 1061979158 9:134090222-134090244 CCCACATGTACAAGGTTGTGCAT No data
Right 1061979165 9:134090254-134090276 TGTCCACAGAGGCCAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979165 Original CRISPR TGTCCACAGAGGCCAGGAAG TGG Intergenic
No off target data available for this crispr