ID: 1061979169

View in Genome Browser
Species Human (GRCh38)
Location 9:134090267-134090289
Sequence CAGGAAGTGGCAGGTTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979163_1061979169 -4 Left 1061979163 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
Right 1061979169 9:134090267-134090289 CAGGAAGTGGCAGGTTAAGAAGG No data
1061979159_1061979169 21 Left 1061979159 9:134090223-134090245 CCACATGTACAAGGTTGTGCATA No data
Right 1061979169 9:134090267-134090289 CAGGAAGTGGCAGGTTAAGAAGG No data
1061979158_1061979169 22 Left 1061979158 9:134090222-134090244 CCCACATGTACAAGGTTGTGCAT No data
Right 1061979169 9:134090267-134090289 CAGGAAGTGGCAGGTTAAGAAGG No data
1061979157_1061979169 29 Left 1061979157 9:134090215-134090237 CCTTGTGCCCACATGTACAAGGT No data
Right 1061979169 9:134090267-134090289 CAGGAAGTGGCAGGTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979169 Original CRISPR CAGGAAGTGGCAGGTTAAGA AGG Intergenic
No off target data available for this crispr