ID: 1061979173

View in Genome Browser
Species Human (GRCh38)
Location 9:134090281-134090303
Sequence TTAAGAAGGGGGTCAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061979163_1061979173 10 Left 1061979163 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG No data
Right 1061979173 9:134090281-134090303 TTAAGAAGGGGGTCAGAAAGTGG No data
1061979166_1061979173 1 Left 1061979166 9:134090257-134090279 CCACAGAGGCCAGGAAGTGGCAG No data
Right 1061979173 9:134090281-134090303 TTAAGAAGGGGGTCAGAAAGTGG No data
1061979168_1061979173 -8 Left 1061979168 9:134090266-134090288 CCAGGAAGTGGCAGGTTAAGAAG No data
Right 1061979173 9:134090281-134090303 TTAAGAAGGGGGTCAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061979173 Original CRISPR TTAAGAAGGGGGTCAGAAAG TGG Intergenic
No off target data available for this crispr