ID: 1061980803

View in Genome Browser
Species Human (GRCh38)
Location 9:134102409-134102431
Sequence CTTGTTGCTCACCAGATTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061980803_1061980813 21 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980813 9:134102453-134102475 CTTTTGACAGGGTGTACCCGGGG No data
1061980803_1061980816 26 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980816 9:134102458-134102480 GACAGGGTGTACCCGGGGTGGGG No data
1061980803_1061980805 9 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980805 9:134102441-134102463 CTGCCCCTTCCACTTTTGACAGG No data
1061980803_1061980811 19 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980811 9:134102451-134102473 CACTTTTGACAGGGTGTACCCGG No data
1061980803_1061980814 24 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980814 9:134102456-134102478 TTGACAGGGTGTACCCGGGGTGG No data
1061980803_1061980806 10 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980806 9:134102442-134102464 TGCCCCTTCCACTTTTGACAGGG No data
1061980803_1061980812 20 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980812 9:134102452-134102474 ACTTTTGACAGGGTGTACCCGGG No data
1061980803_1061980815 25 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980815 9:134102457-134102479 TGACAGGGTGTACCCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061980803 Original CRISPR CTTGTTGCTCACCAGATTCT TGG (reversed) Intergenic
No off target data available for this crispr