ID: 1061980811

View in Genome Browser
Species Human (GRCh38)
Location 9:134102451-134102473
Sequence CACTTTTGACAGGGTGTACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061980803_1061980811 19 Left 1061980803 9:134102409-134102431 CCAAGAATCTGGTGAGCAACAAG No data
Right 1061980811 9:134102451-134102473 CACTTTTGACAGGGTGTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061980811 Original CRISPR CACTTTTGACAGGGTGTACC CGG Intergenic
No off target data available for this crispr