ID: 1061981689

View in Genome Browser
Species Human (GRCh38)
Location 9:134108409-134108431
Sequence CCTCCTATGTGGGAGCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061981682_1061981689 10 Left 1061981682 9:134108376-134108398 CCAAGCACAGAAAGACAAACATC 0: 21
1: 497
2: 1515
3: 2667
4: 3884
Right 1061981689 9:134108409-134108431 CCTCCTATGTGGGAGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061981689 Original CRISPR CCTCCTATGTGGGAGCTACA AGG Intergenic
No off target data available for this crispr