ID: 1061981689 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:134108409-134108431 |
| Sequence | CCTCCTATGTGGGAGCTACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1061981682_1061981689 | 10 | Left | 1061981682 | 9:134108376-134108398 | CCAAGCACAGAAAGACAAACATC | 0: 21 1: 497 2: 1515 3: 2667 4: 3884 |
||
| Right | 1061981689 | 9:134108409-134108431 | CCTCCTATGTGGGAGCTACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1061981689 | Original CRISPR | CCTCCTATGTGGGAGCTACA AGG | Intergenic | ||
| No off target data available for this crispr | |||||