ID: 1061987217

View in Genome Browser
Species Human (GRCh38)
Location 9:134136539-134136561
Sequence TCTGGGGTCCTTCCCTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061987217_1061987225 1 Left 1061987217 9:134136539-134136561 CCCCTTCAGGGAAGGACCCCAGA 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1061987225 9:134136563-134136585 CCACCAAGCCACTCAGTCCCTGG No data
1061987217_1061987227 7 Left 1061987217 9:134136539-134136561 CCCCTTCAGGGAAGGACCCCAGA 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1061987227 9:134136569-134136591 AGCCACTCAGTCCCTGGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061987217 Original CRISPR TCTGGGGTCCTTCCCTGAAG GGG (reversed) Intronic
900534839 1:3171718-3171740 CCTGGGGTCCTTCCAGAAAGAGG - Intronic
900598641 1:3493743-3493765 TCTGGGGTCCTGCCCAGGAAGGG - Intronic
902287550 1:15416358-15416380 TGTGGGGACCTTCCCTGCTGAGG - Intronic
902341193 1:15784699-15784721 GCTGGGGCCCTTCCCTGACTTGG + Intronic
905915274 1:41680036-41680058 TTTTGGATCCTGCCCTGAAGGGG + Intronic
906519768 1:46460089-46460111 TCTGGGATCCTGGCCTCAAGGGG + Intergenic
907246843 1:53114204-53114226 TCTGCAGTGCTTCCCTGGAGAGG + Intronic
912020430 1:105102605-105102627 TCTGGGGTCCATGCCTGTAAGGG + Intergenic
915244472 1:154546607-154546629 TCTTGGGTCATTGCATGAAGAGG + Intronic
916194301 1:162209229-162209251 ACTGGTGCCCATCCCTGAAGGGG - Intronic
916644598 1:166770502-166770524 GCTGAGGTCCTGCCATGAAGGGG - Intergenic
920666921 1:207969767-207969789 TCTTGTGCCCATCCCTGAAGAGG + Intergenic
922032235 1:221812587-221812609 GCTGGGTTCCTTCCCAGAAGGGG + Intergenic
923273154 1:232375356-232375378 TCCAGGGGCCTTCCCTGATGTGG - Intergenic
924508615 1:244710137-244710159 TCTGGGGCCCTGCCCTGATCTGG + Intergenic
1064343905 10:14513260-14513282 CTTGGTGTCCTTCCCAGAAGTGG - Intergenic
1065598427 10:27341931-27341953 TCAGGGTGCCTTCCATGAAGTGG + Intergenic
1067374958 10:45719336-45719358 CCTGGGGGGCTTCCGTGAAGAGG + Intergenic
1067882771 10:50060977-50060999 CCTGGGGGGCTTCCGTGAAGAGG + Intergenic
1067886471 10:50093865-50093887 CCTGGGGGGCTTCCGTGAAGAGG - Exonic
1069886062 10:71624300-71624322 TCTCTCGTCCTTCCCTGAAAAGG - Intronic
1070373809 10:75809952-75809974 TGTGGGGTCCTTCTGTGCAGGGG + Intronic
1072071437 10:91921880-91921902 TCTGGGAGCCTTCCAGGAAGAGG - Intergenic
1073111297 10:101064497-101064519 TCTGGGGTCCACCCCTAAACTGG - Exonic
1074185159 10:111094680-111094702 TCAGGGGCCCATCCCTGAATCGG + Intergenic
1074185864 10:111098963-111098985 ACTCAGGTCCTTCCATGAAGTGG + Intergenic
1074819331 10:117166963-117166985 CCTGGGGGCCTTTCCTGCAGCGG - Intergenic
1076411165 10:130252057-130252079 ACTGGTGTCCTTACCAGAAGAGG - Intergenic
1077186633 11:1238405-1238427 CCTGGGGGCCTTCCCTCCAGCGG - Intronic
1077351912 11:2096994-2097016 CCTGGGGTTCTCCCCTGGAGAGG + Intergenic
1077437547 11:2550020-2550042 TCTGGGGTCCGTCCCTCTCGAGG - Intronic
1077457224 11:2688354-2688376 TCTGGGGAACTTCCCCGTAGAGG + Intronic
1079290193 11:19181123-19181145 ACTGGTGTCCTTCCAAGAAGTGG + Intergenic
1084405666 11:68971428-68971450 TCTGGGGGACTTCCCGGAGGAGG - Intergenic
1084710221 11:70839576-70839598 GCTGTGGTCCTTTCCTGATGGGG - Intronic
1085126217 11:74004429-74004451 TCTGGGTTCCCTCCCTGCTGAGG + Intronic
1090047513 11:123349134-123349156 TCTGGGTCCCCTCCCTGAAAGGG - Intergenic
1090282600 11:125469059-125469081 TCTGGCCTCCTTCCCTGAGTAGG + Intronic
1091107873 11:132939739-132939761 CCTGGGCTCCTTTCCTGATGTGG + Intronic
1091702384 12:2672650-2672672 GCTGGTGTCCTTCCAAGAAGAGG - Intronic
1092032588 12:5300423-5300445 TCTGGAGTCTCTTCCTGAAGAGG - Intergenic
1093300784 12:17452051-17452073 TCTGTGCTCCCTCCCTGGAGGGG - Intergenic
1094598242 12:31884840-31884862 TCTGGGGGTCTTCCCAGCAGCGG - Intergenic
1095357490 12:41292971-41292993 TCTGGGGTCCTTGCATGCTGTGG + Intronic
1095783998 12:46090435-46090457 TCAGGGATCCAGCCCTGAAGGGG + Intergenic
1102019565 12:109672655-109672677 GCTGGTGTCCTCCCCTGAGGAGG - Intergenic
1102482157 12:113231396-113231418 ACTGGTGTCCTTATCTGAAGAGG - Intronic
1104944567 12:132409850-132409872 TCTGGGTTCCATCCCTGAGCCGG - Intergenic
1105447494 13:20470336-20470358 TGTGGTCTCCTTCCCTGCAGCGG - Intronic
1106487232 13:30182391-30182413 CCTGGAGGCCTTTCCTGAAGAGG + Intergenic
1107205493 13:37780850-37780872 TCTCGGTGCCTTCACTGAAGAGG + Intronic
1108088772 13:46823453-46823475 TATGGGCTCCTTCCCACAAGGGG - Intergenic
1108259284 13:48640948-48640970 TCCGGTTTCCTCCCCTGAAGTGG + Intergenic
1108508945 13:51137454-51137476 TATGCTGTCCCTCCCTGAAGGGG + Intergenic
1110111064 13:71746764-71746786 TCTGGGTTCCTTCCCAGAAGTGG + Intronic
1110984886 13:81954667-81954689 ACTGGTGTCCTTATCTGAAGGGG + Intergenic
1113699853 13:112376253-112376275 GCTGGGGTCCTGCCCTGGTGGGG - Intergenic
1114259369 14:21025837-21025859 TCTGGGGTCAATGCCTCAAGGGG + Intronic
1115665579 14:35541617-35541639 TCTGCAGTGCTTCCCTAAAGGGG - Intronic
1115795515 14:36930996-36931018 TCTGAGATGCTTCCCTGAACTGG + Intronic
1119139300 14:72251219-72251241 TCTTGGGTAATTTCCTGAAGCGG + Intronic
1119957195 14:78811302-78811324 TCTAGGATCCTTCCATGAGGTGG + Intronic
1121875132 14:97444082-97444104 GCTGTGGTCCTTCCCTGAAAAGG + Intergenic
1123099633 14:105787962-105787984 TTTGGGTTCCTTGCCTGAAAAGG - Intergenic
1124106455 15:26742220-26742242 TCTTGGGTCCTTCCCAGGACTGG + Intronic
1124239307 15:28016960-28016982 TCTGGGGCCCTTCCTTGCAGGGG - Intronic
1124354364 15:28984141-28984163 TGTAGGGTCCTGCCCTGGAGGGG + Intronic
1124744545 15:32328149-32328171 TCTGGGGTCCTAACCTCCAGTGG - Intergenic
1125078349 15:35647625-35647647 TCTGGGGTCCTCACTTGGAGAGG + Intergenic
1126762001 15:51977855-51977877 CCTGGGCTCCTTCACTGAGGTGG - Intronic
1128977095 15:72162032-72162054 TCTGGGCCCTTTCCCTGATGTGG - Intronic
1129685621 15:77684751-77684773 ACTGGGGTCCTTGCCTGGGGAGG - Intronic
1129970359 15:79773018-79773040 TCTGGGCTCTTTCCCTGGAGTGG + Intergenic
1130923140 15:88365770-88365792 TCTGGGGTCCTGGACAGAAGGGG - Intergenic
1131620823 15:94066151-94066173 TCTGAAGTCCTTCTCTCAAGGGG + Intergenic
1132190239 15:99848959-99848981 TCTCGGATCCTTCCCTGCCGAGG + Intergenic
1136294659 16:29294840-29294862 TCTGTGAGCCTCCCCTGAAGAGG + Intergenic
1136620249 16:31423798-31423820 TGAGGGGTTCTTCCCTGAGGAGG - Intronic
1137022073 16:35438423-35438445 CATGGCCTCCTTCCCTGAAGTGG - Intergenic
1138465488 16:57186716-57186738 TCGGGGGTCCTCACCAGAAGAGG + Exonic
1140971546 16:80018056-80018078 TCTGGGATGCTTCTCTAAAGAGG - Intergenic
1141003232 16:80327699-80327721 TCTGGGCCCCTTCCCTGAGGAGG - Intergenic
1142100563 16:88268884-88268906 TCTGTGAGCCTCCCCTGAAGAGG + Intergenic
1145690355 17:26732468-26732490 TGTGGGGTCCTGACCTCAAGGGG + Intergenic
1146807614 17:35877897-35877919 TATGGGGTTCTTCACTGAAGGGG + Intronic
1147332318 17:39706250-39706272 TCTGGAGTCTTGCCCTGAGGAGG + Intronic
1147521455 17:41177364-41177386 TCTGATGTTCTTCCCTGCAGAGG - Intergenic
1148187272 17:45653779-45653801 TCTGGGATTCTACCCTCAAGTGG + Intergenic
1148701767 17:49591623-49591645 TCAGGGTCCCTTCCCTGAAACGG + Intergenic
1149773811 17:59341809-59341831 TCTGGGTTTCTTCTCTGAATGGG - Intronic
1149813470 17:59700869-59700891 TCTGAGCTCCTTCCCTCAGGGGG - Exonic
1150273030 17:63878933-63878955 TCTGGGGTGCTTTCCTGATGGGG + Intronic
1150278689 17:63916232-63916254 TCTGGGGTGCTTTCCTGATGGGG + Intronic
1150279787 17:63922851-63922873 TCTGGGGTGCTTTCCTGATGGGG + Intergenic
1151109279 17:71655653-71655675 TTTGGGGTCCTTCTCTGTAGGGG + Intergenic
1151258514 17:72898458-72898480 TCTGGGCTTCTCCCCTGAACAGG + Intronic
1152261375 17:79269081-79269103 ACTGGGGTCCTTCTGAGAAGGGG + Intronic
1152830467 17:82494202-82494224 GCTGGGTTCCTTACCTGGAGGGG + Intergenic
1153426286 18:4968378-4968400 TCTGTTGTTTTTCCCTGAAGAGG + Intergenic
1158317761 18:56230490-56230512 TCTGTGATGCTTCCCTGATGTGG - Intergenic
1158349591 18:56551426-56551448 TATGGGGACCTTCCCTGATGGGG - Intergenic
1159638811 18:70839335-70839357 CCTGGGAGCCTTCCCTGAAATGG + Intergenic
1159676246 18:71287400-71287422 ACTGGCGTCCTTCCAAGAAGAGG - Intergenic
1160714486 19:570067-570089 CCGGTGGTCCTTCCCTAAAGGGG + Intergenic
1160765468 19:805682-805704 TCAGGGGCCCTTCCCGGGAGAGG + Intronic
1160885386 19:1344394-1344416 GCTGGGGTCCAACCCTGAAGTGG + Intergenic
1161093453 19:2375337-2375359 TCTTGGGTCCATCACTGATGGGG + Intergenic
1161119885 19:2519716-2519738 CCTGGGGTCCTTCCAGGAGGAGG + Intronic
1162020607 19:7866784-7866806 TCTGCGGTCCTGCCCTGACCTGG - Intergenic
1164891880 19:31830927-31830949 CCTGGGGACCTTCCTTAAAGAGG - Intergenic
1167510377 19:49892695-49892717 TCTGAGGTCCTGGCCAGAAGGGG - Intronic
1168254731 19:55159180-55159202 TGTGGGGTCCCACCCTGCAGAGG + Exonic
1168489325 19:56795218-56795240 TCCTGGGTCCCTCCCTGCAGGGG + Intronic
925355273 2:3236597-3236619 TCTGGGATCCTGTCCTGAAATGG - Intronic
925725568 2:6867408-6867430 ACTGGTGTCCTTCCCAGAAGAGG - Intronic
926735825 2:16072668-16072690 TGTGGGCTCCTTCCCCGCAGAGG + Intergenic
927199990 2:20572128-20572150 TCTGAAGTCTTTCCTTGAAGGGG + Intronic
932288974 2:70559353-70559375 GCGGGGGTCCTTCCCTGGAGAGG - Intergenic
935133415 2:100278353-100278375 TCTGGGCTCCAGCCCTGATGGGG - Exonic
935707984 2:105872914-105872936 TCTGATGCCCTTCCCGGAAGTGG + Intronic
935877338 2:107524433-107524455 TATGGGGTCTTGCCCTCAAGTGG - Intergenic
935975148 2:108570809-108570831 TCTGCAGTCCTGCCCTGGAGGGG + Intronic
936064457 2:109319910-109319932 TCTGGGGTCCCTCCTTGCAGGGG + Intronic
938082281 2:128376570-128376592 TCCTGGGTCCTTCCCCAAAGGGG - Intergenic
938733413 2:134164128-134164150 TCTAGGGTCCTTCCCCAAATTGG + Intronic
942614540 2:177776678-177776700 ACTGGGGTCCTTACAAGAAGAGG + Intronic
943917750 2:193658970-193658992 TCTGGGCTCCCTCTCTGCAGTGG + Intergenic
944123161 2:196263264-196263286 TCTGGGGTGATTCCGTGCAGAGG - Intronic
944878240 2:203984933-203984955 GCAGGAGTCTTTCCCTGAAGAGG - Intergenic
945206203 2:207334906-207334928 TCTGGGATTCTTTCCTCAAGAGG + Intergenic
946510036 2:220346196-220346218 TCTGGAGGCCTCCCCAGAAGCGG - Intergenic
947112017 2:226728875-226728897 GCTGGGGTCCTGCCCTCGAGTGG + Intergenic
948177644 2:235956694-235956716 CATGGGGCCCTACCCTGAAGGGG - Intronic
948522145 2:238546614-238546636 TCTTGGATCGTTCCCTGAGGTGG - Intergenic
949065567 2:241988240-241988262 TCTGGGGTCCATGCGTGGAGAGG + Intergenic
1170344161 20:15364791-15364813 ACTGGGATCCTTCTATGAAGTGG + Intronic
1171344293 20:24453764-24453786 TCTGGGGTCCTTTCAAGGAGTGG - Intergenic
1172769954 20:37376124-37376146 TCTGGGTTCTTTCCCTGTAAAGG + Intronic
1172790768 20:37503907-37503929 TCTGGGAGGCTTCCCTGAGGAGG - Intronic
1175600944 20:60272512-60272534 TCAGGGGCCCTTTCCTGAACAGG + Intergenic
1175899864 20:62355700-62355722 TATAGGGTCTGTCCCTGAAGAGG - Intronic
1176108132 20:63399116-63399138 TGTGGGGTCTGTCCCTGGAGGGG + Intergenic
1176108143 20:63399141-63399163 CGTGGGGTCCATCCCTGGAGGGG + Intergenic
1176108153 20:63399164-63399186 TGTGGGGTCCATCCTTGGAGGGG + Intergenic
1176172327 20:63701604-63701626 TCTGGGCGCCTGCCCTGAGGTGG + Intronic
1176377350 21:6093089-6093111 TCTGGGGTCCTGCCTTACAGGGG + Intergenic
1178310977 21:31529813-31529835 TCTGCGGACCTTCCCTCGAGAGG - Intronic
1178471669 21:32899123-32899145 TCCAGGGACCTTCCCTGAAAAGG + Intergenic
1179746124 21:43445155-43445177 TCTGGGGTCCTGCCTTACAGGGG - Intergenic
1180707691 22:17819127-17819149 TCTGTCTTCCTTCCCTGTAGGGG - Exonic
1180873264 22:19159989-19160011 TCTGGGGTCCTTTGGTCAAGGGG - Intergenic
1181020692 22:20100650-20100672 TCTGGGGTTCTTCTGTGAAGTGG + Intronic
1181677196 22:24463163-24463185 ACTGGTGTCCTTCCAAGAAGAGG + Intergenic
1181980055 22:26759941-26759963 TCTGGGGCCCATGCCTGATGGGG - Intergenic
1182440719 22:30362384-30362406 CCTGGGGAGCTTTCCTGAAGAGG + Intronic
1184387710 22:44185832-44185854 TTTGGGGTCCTTCCGGGAAGTGG - Exonic
1185040756 22:48502983-48503005 TCTAGGCTCCTGCCCTGCAGAGG + Intronic
950796380 3:15513683-15513705 TTTGGGTTCCTTCTCAGAAGCGG - Intronic
953772108 3:45785748-45785770 TCAGCGCTCCTCCCCTGAAGAGG + Intronic
953792742 3:45960753-45960775 TTTGGGGTCTTTCCTTCAAGAGG - Intronic
954538348 3:51377886-51377908 TCTGGGCGGCTTCCCTAAAGGGG - Intronic
955398376 3:58573506-58573528 TCTGGGGTCCATCCGGGGAGTGG + Intronic
957368051 3:79252339-79252361 TCTGGTGTCCTTCTAAGAAGGGG + Intronic
958819638 3:98958334-98958356 TCTGGGATCCTTCCCATCAGAGG + Intergenic
960614556 3:119584935-119584957 CCTGGTGTCCTTACATGAAGAGG - Intronic
963655096 3:148037816-148037838 TCTGTGCTTCATCCCTGAAGGGG + Intergenic
966123775 3:176551832-176551854 TCTGGGGTTCAGCCCTGAGGCGG - Intergenic
967675030 3:192287602-192287624 ACTGGGGTCCTTCAGTGGAGGGG + Intronic
968490996 4:890430-890452 TCTGGGGTCCTTCTCTCCCGGGG - Intronic
968694877 4:2019311-2019333 GCTGGGGTCCTGCCCTCAGGAGG + Intronic
968835396 4:2960287-2960309 TCTGAGGTCTGTCCCTGCAGAGG + Intronic
969085389 4:4652472-4652494 TCTGGGGCCTTTTCCTGGAGGGG - Intergenic
969660595 4:8525299-8525321 TCAGGGGGCCTTCCTGGAAGAGG + Intergenic
970589170 4:17544448-17544470 TCTGGGCTTCTCCCCGGAAGAGG + Intergenic
970761479 4:19494365-19494387 TCTGGGGACCTTGCCTGGATTGG + Intergenic
971385537 4:26137871-26137893 ACTGGGGCCCGTCCCTGAAGGGG - Intergenic
973584501 4:52376971-52376993 TTTGGGGTCCTTGGCTGAAATGG + Intergenic
974689635 4:65279899-65279921 TCTGGGGTCCTCCAAGGAAGAGG + Intergenic
975492510 4:75004299-75004321 TCAGGGCTCCTAGCCTGAAGGGG + Intronic
975789861 4:77937450-77937472 TCTGGGGTAGATGCCTGAAGAGG + Intronic
983778557 4:171640309-171640331 CCTGTGGTCCTACCCAGAAGTGG + Intergenic
984763107 4:183379042-183379064 TCTGGGGAGCTTCCCAGAAAGGG - Intergenic
984995414 4:185425915-185425937 TCCGGGGGCCGGCCCTGAAGTGG + Exonic
985521262 5:374867-374889 TCCGGGGTCCTGGCCTGATGGGG + Intronic
985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG + Intergenic
986452855 5:7883715-7883737 TCCCTAGTCCTTCCCTGAAGTGG - Intronic
986713283 5:10503174-10503196 ACTGGGGTCCTTATATGAAGAGG - Intergenic
987816482 5:22907472-22907494 ACTGGTGTCCTTCCAAGAAGAGG - Intergenic
990475680 5:56159696-56159718 TCTGTGTTCCTACCCTGAAAGGG - Intronic
990512786 5:56503890-56503912 TCTGGGCTCCTGCCTTGAGGTGG - Intergenic
994215533 5:97132919-97132941 ACTGATGTCCTTCTCTGAAGGGG - Intronic
994669327 5:102747552-102747574 TCAGGTGTCCTTTCCTGAGGAGG + Intergenic
997891963 5:137684908-137684930 TCTGGGGAACTTCCCTGAGGGGG + Intronic
998382133 5:141733279-141733301 TCTGGTGTCCTTCTAAGAAGAGG + Intergenic
1001867939 5:175121596-175121618 TCCAGTGTCCTTCCCTTAAGGGG - Intergenic
1002440434 5:179261802-179261824 TCTGGGGTCCCTCCCCACAGTGG + Intronic
1002842514 6:918345-918367 CTGGGGGTCCTTTCCTGAAGGGG + Intergenic
1003330976 6:5128541-5128563 TATGATTTCCTTCCCTGAAGAGG - Intronic
1006228893 6:32565127-32565149 CCTGGGACCCATCCCTGAAGTGG + Intronic
1006298659 6:33181426-33181448 TCTGGGGACCTTCCTGAAAGAGG - Intronic
1010027897 6:71240510-71240532 TCTTGGGTCCTTTCTTGATGTGG - Intergenic
1010328824 6:74597187-74597209 TCTGGGCTCCTTCCACGTAGTGG - Intergenic
1011227413 6:85122902-85122924 TTTGGAGTCCTTCTCTGAAAAGG - Intergenic
1011649065 6:89489224-89489246 ACTTTGGTCCTTCCCTGAACCGG + Intronic
1013612803 6:111810774-111810796 CCTGGGGCCCTTCCAGGAAGAGG + Intronic
1015625013 6:135172314-135172336 TCTTGGGCCCTTCACAGAAGTGG - Intergenic
1015636580 6:135280630-135280652 TGTGTGGTCTTTTCCTGAAGAGG - Intergenic
1018055697 6:160050469-160050491 GCAGGGCTCCTTCACTGAAGTGG + Exonic
1018647486 6:165961772-165961794 TCTGGGGTTTTGCTCTGAAGCGG - Intronic
1020376701 7:7495546-7495568 TCTGGTGCCCTTCCCTGAGGTGG - Intronic
1020745292 7:12072041-12072063 CCTGGGCTCCTTCCCCAAAGGGG - Intergenic
1025744740 7:64232924-64232946 TCTTGGGCCCTGCCCTTAAGGGG - Intronic
1025751908 7:64301243-64301265 TCTTGGGTCCTGCCTTTAAGAGG - Intergenic
1026219290 7:68378587-68378609 TCTAGGGTCCTTCACTTCAGTGG + Intergenic
1026805694 7:73428839-73428861 TCTGGGAGCCTGCCCTGGAGTGG - Intergenic
1026901626 7:74040505-74040527 TTTGGGATCCATCCCTGGAGAGG + Intronic
1029294188 7:99526393-99526415 TCTGGGATTTCTCCCTGAAGTGG - Exonic
1029596204 7:101538748-101538770 TCTGGGCTCCTCCCCAGCAGGGG - Intronic
1032455627 7:132071319-132071341 TCTGGGGTCCCTCTCTGAGTTGG - Intergenic
1032917974 7:136512403-136512425 CATGGTGTCCTTCCATGAAGCGG + Intergenic
1034478743 7:151303762-151303784 GCTGGGGTGCTGCGCTGAAGGGG - Intergenic
1035664283 8:1369389-1369411 ACTGGGGTCCTTACAGGAAGGGG - Intergenic
1036678705 8:10854900-10854922 TCTGGGTGCCTGCCCTGAAGGGG + Intergenic
1037331458 8:17747679-17747701 TCTGGGGTCTTTACATGAATGGG - Intronic
1037775419 8:21832470-21832492 TCTGGGGTCCTTTACAGAAAAGG + Intergenic
1037922464 8:22817041-22817063 TTTGAGGACCCTCCCTGAAGAGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1039770492 8:40681550-40681572 GGTGAGGTGCTTCCCTGAAGAGG - Intronic
1039806275 8:41002387-41002409 TCTGAGCTCCTTCCCTGCTGGGG + Intergenic
1042814813 8:72866881-72866903 TCTGGGATACCTCCCTGGAGAGG - Intronic
1044387071 8:91601796-91601818 TCTGGTGTCCTTCTATGAAGAGG - Intergenic
1046001516 8:108426048-108426070 TCTGGGGACATCCCCAGAAGAGG - Intronic
1046041145 8:108906433-108906455 TCTGGTCTCCTTGCCTCAAGAGG - Intergenic
1048293889 8:133200317-133200339 CCTGAGCTCCTTCCCTGGAGGGG - Intronic
1048366902 8:133746064-133746086 TCAGGGGTGCTTCTCAGAAGCGG + Intergenic
1057754433 9:97820533-97820555 CCTGCTGTCCTTCCCTGAAGGGG + Intergenic
1059157579 9:112003756-112003778 TCTGGGGTTTACCCCTGAAGAGG - Intergenic
1059619647 9:115989176-115989198 TCTGGGGTCTTTCCATGGATGGG - Intergenic
1061987217 9:134136539-134136561 TCTGGGGTCCTTCCCTGAAGGGG - Intronic
1062382630 9:136294779-136294801 CCTGGGGTCCTGTCCTGGAGAGG - Intronic
1062382644 9:136294815-136294837 TAAGGGGTCCTGCCCTAAAGTGG - Intronic
1186713580 X:12226735-12226757 TCAGGGTTCCTTTCCTGTAGTGG - Intronic
1187133740 X:16527109-16527131 TCTGTGGCCCTACCCAGAAGGGG + Intergenic
1187311602 X:18149432-18149454 TCTGGCGTCCTTGCTTCAAGGGG + Intergenic
1187431248 X:19227305-19227327 TCTAGGGTCTTTCCCTAGAGTGG - Intergenic
1188859432 X:35239281-35239303 CCTGGTGTCCTTACATGAAGAGG + Intergenic
1191104148 X:56761906-56761928 TCTGGGGTCCTACCCTTCATTGG + Intergenic
1195707126 X:107745298-107745320 TCTAGGTTCCTTTCCAGAAGTGG + Intronic
1195847066 X:109240298-109240320 TCTATGGTCCTGTCCTGAAGGGG + Intergenic
1201147662 Y:11073666-11073688 GCTGGTGTCCTTACCAGAAGAGG + Intergenic