ID: 1061991753

View in Genome Browser
Species Human (GRCh38)
Location 9:134163219-134163241
Sequence GGCACCGCGTCCTTCCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061991748_1061991753 3 Left 1061991748 9:134163193-134163215 CCGCAGCCTTGGCTGTTTCAGCA No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991747_1061991753 4 Left 1061991747 9:134163192-134163214 CCCGCAGCCTTGGCTGTTTCAGC No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991742_1061991753 20 Left 1061991742 9:134163176-134163198 CCCGGGGCCTGCGCCTCCCGCAG No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991740_1061991753 29 Left 1061991740 9:134163167-134163189 CCTCCAGCTCCCGGGGCCTGCGC No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991743_1061991753 19 Left 1061991743 9:134163177-134163199 CCGGGGCCTGCGCCTCCCGCAGC No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991739_1061991753 30 Left 1061991739 9:134163166-134163188 CCCTCCAGCTCCCGGGGCCTGCG No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991741_1061991753 26 Left 1061991741 9:134163170-134163192 CCAGCTCCCGGGGCCTGCGCCTC No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991746_1061991753 7 Left 1061991746 9:134163189-134163211 CCTCCCGCAGCCTTGGCTGTTTC No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991751_1061991753 -3 Left 1061991751 9:134163199-134163221 CCTTGGCTGTTTCAGCAGGTGGC No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data
1061991745_1061991753 13 Left 1061991745 9:134163183-134163205 CCTGCGCCTCCCGCAGCCTTGGC No data
Right 1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061991753 Original CRISPR GGCACCGCGTCCTTCCCCGG AGG Intergenic