ID: 1061994075

View in Genome Browser
Species Human (GRCh38)
Location 9:134175292-134175314
Sequence ACAGCTCTGCAAAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061994070_1061994075 16 Left 1061994070 9:134175253-134175275 CCAGGGAAGAGGGGAAGGAGAGG No data
Right 1061994075 9:134175292-134175314 ACAGCTCTGCAAAGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061994075 Original CRISPR ACAGCTCTGCAAAGGCCCTG AGG Intergenic
No off target data available for this crispr