ID: 1061994132

View in Genome Browser
Species Human (GRCh38)
Location 9:134175451-134175473
Sequence CTCTGCCCAAACCACCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061994132_1061994145 25 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994145 9:134175499-134175521 AGGGAGTCCCTGTGGTTGCCCGG No data
1061994132_1061994146 26 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994146 9:134175500-134175522 GGGAGTCCCTGTGGTTGCCCGGG No data
1061994132_1061994139 -1 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994139 9:134175473-134175495 GGTGGGCAGCATGGAGGCGGTGG No data
1061994132_1061994147 29 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994147 9:134175503-134175525 AGTCCCTGTGGTTGCCCGGGTGG No data
1061994132_1061994137 -7 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994137 9:134175467-134175489 GGCAGAGGTGGGCAGCATGGAGG No data
1061994132_1061994140 5 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994140 9:134175479-134175501 CAGCATGGAGGCGGTGGCCCAGG No data
1061994132_1061994138 -4 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994138 9:134175470-134175492 AGAGGTGGGCAGCATGGAGGCGG No data
1061994132_1061994142 17 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994142 9:134175491-134175513 GGTGGCCCAGGGAGTCCCTGTGG No data
1061994132_1061994141 6 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994141 9:134175480-134175502 AGCATGGAGGCGGTGGCCCAGGG No data
1061994132_1061994136 -10 Left 1061994132 9:134175451-134175473 CCTGAGAGGTGGTTTGGGCAGAG No data
Right 1061994136 9:134175464-134175486 TTGGGCAGAGGTGGGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061994132 Original CRISPR CTCTGCCCAAACCACCTCTC AGG (reversed) Intergenic
No off target data available for this crispr