ID: 1062000571

View in Genome Browser
Species Human (GRCh38)
Location 9:134213861-134213883
Sequence CAGGCCTAGGATTCTGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062000571_1062000582 -1 Left 1062000571 9:134213861-134213883 CCCGGGACAGAATCCTAGGCCTG No data
Right 1062000582 9:134213883-134213905 GGGGGAGGGGAAGCAGTGACAGG No data
1062000571_1062000583 0 Left 1062000571 9:134213861-134213883 CCCGGGACAGAATCCTAGGCCTG No data
Right 1062000583 9:134213884-134213906 GGGGAGGGGAAGCAGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062000571 Original CRISPR CAGGCCTAGGATTCTGTCCC GGG (reversed) Intergenic
No off target data available for this crispr