ID: 1062001571

View in Genome Browser
Species Human (GRCh38)
Location 9:134218519-134218541
Sequence GGCTGCAAAGCACCCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062001571_1062001581 8 Left 1062001571 9:134218519-134218541 CCCACTTGGGGTGCTTTGCAGCC No data
Right 1062001581 9:134218550-134218572 CCTTCAGGCAGGCACAGAGGTGG No data
1062001571_1062001575 -3 Left 1062001571 9:134218519-134218541 CCCACTTGGGGTGCTTTGCAGCC No data
Right 1062001575 9:134218539-134218561 GCCTTGAGGCCCCTTCAGGCAGG No data
1062001571_1062001582 9 Left 1062001571 9:134218519-134218541 CCCACTTGGGGTGCTTTGCAGCC No data
Right 1062001582 9:134218551-134218573 CTTCAGGCAGGCACAGAGGTGGG No data
1062001571_1062001574 -7 Left 1062001571 9:134218519-134218541 CCCACTTGGGGTGCTTTGCAGCC No data
Right 1062001574 9:134218535-134218557 TGCAGCCTTGAGGCCCCTTCAGG No data
1062001571_1062001584 21 Left 1062001571 9:134218519-134218541 CCCACTTGGGGTGCTTTGCAGCC No data
Right 1062001584 9:134218563-134218585 ACAGAGGTGGGAGCCACTGGAGG No data
1062001571_1062001577 5 Left 1062001571 9:134218519-134218541 CCCACTTGGGGTGCTTTGCAGCC No data
Right 1062001577 9:134218547-134218569 GCCCCTTCAGGCAGGCACAGAGG No data
1062001571_1062001583 18 Left 1062001571 9:134218519-134218541 CCCACTTGGGGTGCTTTGCAGCC No data
Right 1062001583 9:134218560-134218582 GGCACAGAGGTGGGAGCCACTGG No data
1062001571_1062001585 22 Left 1062001571 9:134218519-134218541 CCCACTTGGGGTGCTTTGCAGCC No data
Right 1062001585 9:134218564-134218586 CAGAGGTGGGAGCCACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062001571 Original CRISPR GGCTGCAAAGCACCCCAAGT GGG (reversed) Intergenic
No off target data available for this crispr