ID: 1062001996

View in Genome Browser
Species Human (GRCh38)
Location 9:134220843-134220865
Sequence TTGTAGCTACAGATGAGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062001992_1062001996 14 Left 1062001992 9:134220806-134220828 CCATGTGGGCTCATGATTTGGGG No data
Right 1062001996 9:134220843-134220865 TTGTAGCTACAGATGAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062001996 Original CRISPR TTGTAGCTACAGATGAGAAT AGG Intergenic
No off target data available for this crispr