ID: 1062005030

View in Genome Browser
Species Human (GRCh38)
Location 9:134234793-134234815
Sequence CCAAGGGTATGGCGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062005030_1062005048 27 Left 1062005030 9:134234793-134234815 CCCTCTTCCCGCCATACCCTTGG No data
Right 1062005048 9:134234843-134234865 GCATACACACCCCTGTCCTCTGG No data
1062005030_1062005041 5 Left 1062005030 9:134234793-134234815 CCCTCTTCCCGCCATACCCTTGG No data
Right 1062005041 9:134234821-134234843 CCGCCCACCCCTCTGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062005030 Original CRISPR CCAAGGGTATGGCGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr