ID: 1062007823

View in Genome Browser
Species Human (GRCh38)
Location 9:134250271-134250293
Sequence CCGAGATCACATTGCCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062007823_1062007826 -2 Left 1062007823 9:134250271-134250293 CCAGGTTGGCAATGTGATCTCGG No data
Right 1062007826 9:134250292-134250314 GGAGTCAGCCTCCAGGACTGCGG No data
1062007823_1062007825 -9 Left 1062007823 9:134250271-134250293 CCAGGTTGGCAATGTGATCTCGG No data
Right 1062007825 9:134250285-134250307 TGATCTCGGAGTCAGCCTCCAGG No data
1062007823_1062007830 29 Left 1062007823 9:134250271-134250293 CCAGGTTGGCAATGTGATCTCGG No data
Right 1062007830 9:134250323-134250345 TCTCTGTTGTTGAAGTCACCCGG No data
1062007823_1062007827 -1 Left 1062007823 9:134250271-134250293 CCAGGTTGGCAATGTGATCTCGG No data
Right 1062007827 9:134250293-134250315 GAGTCAGCCTCCAGGACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062007823 Original CRISPR CCGAGATCACATTGCCAACC TGG (reversed) Intergenic