ID: 1062007828

View in Genome Browser
Species Human (GRCh38)
Location 9:134250300-134250322
Sequence CTCGTTTCCCGCAGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062007828_1062007830 0 Left 1062007828 9:134250300-134250322 CCTCCAGGACTGCGGGAAACGAG No data
Right 1062007830 9:134250323-134250345 TCTCTGTTGTTGAAGTCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062007828 Original CRISPR CTCGTTTCCCGCAGTCCTGG AGG (reversed) Intergenic
No off target data available for this crispr