ID: 1062007829

View in Genome Browser
Species Human (GRCh38)
Location 9:134250303-134250325
Sequence AGACTCGTTTCCCGCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062007829_1062007830 -3 Left 1062007829 9:134250303-134250325 CCAGGACTGCGGGAAACGAGTCT No data
Right 1062007830 9:134250323-134250345 TCTCTGTTGTTGAAGTCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062007829 Original CRISPR AGACTCGTTTCCCGCAGTCC TGG (reversed) Intergenic