ID: 1062008800

View in Genome Browser
Species Human (GRCh38)
Location 9:134256162-134256184
Sequence AAGGGGGCCCGGCGGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062008788_1062008800 4 Left 1062008788 9:134256135-134256157 CCTTGGAGCCCAGGGGATTCCAG No data
Right 1062008800 9:134256162-134256184 AAGGGGGCCCGGCGGTAGGTAGG No data
1062008790_1062008800 -4 Left 1062008790 9:134256143-134256165 CCCAGGGGATTCCAGAAGGAAGG No data
Right 1062008800 9:134256162-134256184 AAGGGGGCCCGGCGGTAGGTAGG No data
1062008784_1062008800 15 Left 1062008784 9:134256124-134256146 CCAGAGTGGAGCCTTGGAGCCCA No data
Right 1062008800 9:134256162-134256184 AAGGGGGCCCGGCGGTAGGTAGG No data
1062008792_1062008800 -5 Left 1062008792 9:134256144-134256166 CCAGGGGATTCCAGAAGGAAGGG No data
Right 1062008800 9:134256162-134256184 AAGGGGGCCCGGCGGTAGGTAGG No data
1062008783_1062008800 16 Left 1062008783 9:134256123-134256145 CCCAGAGTGGAGCCTTGGAGCCC No data
Right 1062008800 9:134256162-134256184 AAGGGGGCCCGGCGGTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062008800 Original CRISPR AAGGGGGCCCGGCGGTAGGT AGG Intergenic
No off target data available for this crispr