ID: 1062009025

View in Genome Browser
Species Human (GRCh38)
Location 9:134257204-134257226
Sequence CTCTCTCTGCTGGGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062009015_1062009025 26 Left 1062009015 9:134257155-134257177 CCGGCTCTCTGTGGAGCTCTTTC No data
Right 1062009025 9:134257204-134257226 CTCTCTCTGCTGGGAGTGTCTGG No data
1062009013_1062009025 30 Left 1062009013 9:134257151-134257173 CCCACCGGCTCTCTGTGGAGCTC No data
Right 1062009025 9:134257204-134257226 CTCTCTCTGCTGGGAGTGTCTGG No data
1062009022_1062009025 -10 Left 1062009022 9:134257191-134257213 CCAGACTGTGGGGCTCTCTCTGC No data
Right 1062009025 9:134257204-134257226 CTCTCTCTGCTGGGAGTGTCTGG No data
1062009021_1062009025 -9 Left 1062009021 9:134257190-134257212 CCCAGACTGTGGGGCTCTCTCTG No data
Right 1062009025 9:134257204-134257226 CTCTCTCTGCTGGGAGTGTCTGG No data
1062009014_1062009025 29 Left 1062009014 9:134257152-134257174 CCACCGGCTCTCTGTGGAGCTCT No data
Right 1062009025 9:134257204-134257226 CTCTCTCTGCTGGGAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062009025 Original CRISPR CTCTCTCTGCTGGGAGTGTC TGG Intergenic
No off target data available for this crispr