ID: 1062010261

View in Genome Browser
Species Human (GRCh38)
Location 9:134263332-134263354
Sequence TTCCCTCGTGGCCTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062010261_1062010268 12 Left 1062010261 9:134263332-134263354 CCCTCTCCCAGGCCACGAGGGAA No data
Right 1062010268 9:134263367-134263389 TGTGGTGTCTTTTCCTCCGAGGG No data
1062010261_1062010273 28 Left 1062010261 9:134263332-134263354 CCCTCTCCCAGGCCACGAGGGAA No data
Right 1062010273 9:134263383-134263405 CCGAGGGTCCCCTCTGGTTCGGG No data
1062010261_1062010266 -6 Left 1062010261 9:134263332-134263354 CCCTCTCCCAGGCCACGAGGGAA No data
Right 1062010266 9:134263349-134263371 AGGGAATGCAGAGCAGTGTGTGG No data
1062010261_1062010267 11 Left 1062010261 9:134263332-134263354 CCCTCTCCCAGGCCACGAGGGAA No data
Right 1062010267 9:134263366-134263388 GTGTGGTGTCTTTTCCTCCGAGG No data
1062010261_1062010271 27 Left 1062010261 9:134263332-134263354 CCCTCTCCCAGGCCACGAGGGAA No data
Right 1062010271 9:134263382-134263404 TCCGAGGGTCCCCTCTGGTTCGG No data
1062010261_1062010269 22 Left 1062010261 9:134263332-134263354 CCCTCTCCCAGGCCACGAGGGAA No data
Right 1062010269 9:134263377-134263399 TTTCCTCCGAGGGTCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062010261 Original CRISPR TTCCCTCGTGGCCTGGGAGA GGG (reversed) Intergenic