ID: 1062010264

View in Genome Browser
Species Human (GRCh38)
Location 9:134263339-134263361
Sequence CTCTGCATTCCCTCGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062010264_1062010268 5 Left 1062010264 9:134263339-134263361 CCAGGCCACGAGGGAATGCAGAG No data
Right 1062010268 9:134263367-134263389 TGTGGTGTCTTTTCCTCCGAGGG No data
1062010264_1062010269 15 Left 1062010264 9:134263339-134263361 CCAGGCCACGAGGGAATGCAGAG No data
Right 1062010269 9:134263377-134263399 TTTCCTCCGAGGGTCCCCTCTGG No data
1062010264_1062010267 4 Left 1062010264 9:134263339-134263361 CCAGGCCACGAGGGAATGCAGAG No data
Right 1062010267 9:134263366-134263388 GTGTGGTGTCTTTTCCTCCGAGG No data
1062010264_1062010271 20 Left 1062010264 9:134263339-134263361 CCAGGCCACGAGGGAATGCAGAG No data
Right 1062010271 9:134263382-134263404 TCCGAGGGTCCCCTCTGGTTCGG No data
1062010264_1062010273 21 Left 1062010264 9:134263339-134263361 CCAGGCCACGAGGGAATGCAGAG No data
Right 1062010273 9:134263383-134263405 CCGAGGGTCCCCTCTGGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062010264 Original CRISPR CTCTGCATTCCCTCGTGGCC TGG (reversed) Intergenic
No off target data available for this crispr