ID: 1062010266

View in Genome Browser
Species Human (GRCh38)
Location 9:134263349-134263371
Sequence AGGGAATGCAGAGCAGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062010262_1062010266 -7 Left 1062010262 9:134263333-134263355 CCTCTCCCAGGCCACGAGGGAAT No data
Right 1062010266 9:134263349-134263371 AGGGAATGCAGAGCAGTGTGTGG No data
1062010261_1062010266 -6 Left 1062010261 9:134263332-134263354 CCCTCTCCCAGGCCACGAGGGAA No data
Right 1062010266 9:134263349-134263371 AGGGAATGCAGAGCAGTGTGTGG No data
1062010260_1062010266 -5 Left 1062010260 9:134263331-134263353 CCCCTCTCCCAGGCCACGAGGGA No data
Right 1062010266 9:134263349-134263371 AGGGAATGCAGAGCAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062010266 Original CRISPR AGGGAATGCAGAGCAGTGTG TGG Intergenic