ID: 1062010273

View in Genome Browser
Species Human (GRCh38)
Location 9:134263383-134263405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062010262_1062010273 27 Left 1062010262 9:134263333-134263355 CCTCTCCCAGGCCACGAGGGAAT No data
Right 1062010273 9:134263383-134263405 CCGAGGGTCCCCTCTGGTTCGGG No data
1062010263_1062010273 22 Left 1062010263 9:134263338-134263360 CCCAGGCCACGAGGGAATGCAGA No data
Right 1062010273 9:134263383-134263405 CCGAGGGTCCCCTCTGGTTCGGG No data
1062010264_1062010273 21 Left 1062010264 9:134263339-134263361 CCAGGCCACGAGGGAATGCAGAG No data
Right 1062010273 9:134263383-134263405 CCGAGGGTCCCCTCTGGTTCGGG No data
1062010261_1062010273 28 Left 1062010261 9:134263332-134263354 CCCTCTCCCAGGCCACGAGGGAA No data
Right 1062010273 9:134263383-134263405 CCGAGGGTCCCCTCTGGTTCGGG No data
1062010265_1062010273 16 Left 1062010265 9:134263344-134263366 CCACGAGGGAATGCAGAGCAGTG No data
Right 1062010273 9:134263383-134263405 CCGAGGGTCCCCTCTGGTTCGGG No data
1062010260_1062010273 29 Left 1062010260 9:134263331-134263353 CCCCTCTCCCAGGCCACGAGGGA No data
Right 1062010273 9:134263383-134263405 CCGAGGGTCCCCTCTGGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062010273 Original CRISPR CCGAGGGTCCCCTCTGGTTC GGG Intergenic