ID: 1062015468

View in Genome Browser
Species Human (GRCh38)
Location 9:134289012-134289034
Sequence GCTTGGATGAGGGCGCTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062015468_1062015474 -7 Left 1062015468 9:134289012-134289034 CCACGGAGCGCCCTCATCCAAGC No data
Right 1062015474 9:134289028-134289050 TCCAAGCTGGGCACAGCTCTGGG No data
1062015468_1062015476 30 Left 1062015468 9:134289012-134289034 CCACGGAGCGCCCTCATCCAAGC No data
Right 1062015476 9:134289065-134289087 AACTCGCTGAGCCCTTGTGAAGG No data
1062015468_1062015473 -8 Left 1062015468 9:134289012-134289034 CCACGGAGCGCCCTCATCCAAGC No data
Right 1062015473 9:134289027-134289049 ATCCAAGCTGGGCACAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062015468 Original CRISPR GCTTGGATGAGGGCGCTCCG TGG (reversed) Intergenic