ID: 1062016792

View in Genome Browser
Species Human (GRCh38)
Location 9:134295057-134295079
Sequence ACAGGCCAGCGGTCCACATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062016782_1062016792 18 Left 1062016782 9:134295016-134295038 CCGCAGGTGGGGGTGGTGGGGGG No data
Right 1062016792 9:134295057-134295079 ACAGGCCAGCGGTCCACATTAGG No data
1062016788_1062016792 -10 Left 1062016788 9:134295044-134295066 CCTTGCCCGGTGCACAGGCCAGC No data
Right 1062016792 9:134295057-134295079 ACAGGCCAGCGGTCCACATTAGG No data
1062016780_1062016792 19 Left 1062016780 9:134295015-134295037 CCCGCAGGTGGGGGTGGTGGGGG No data
Right 1062016792 9:134295057-134295079 ACAGGCCAGCGGTCCACATTAGG No data
1062016778_1062016792 20 Left 1062016778 9:134295014-134295036 CCCCGCAGGTGGGGGTGGTGGGG No data
Right 1062016792 9:134295057-134295079 ACAGGCCAGCGGTCCACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062016792 Original CRISPR ACAGGCCAGCGGTCCACATT AGG Intergenic
No off target data available for this crispr