ID: 1062025293

View in Genome Browser
Species Human (GRCh38)
Location 9:134337470-134337492
Sequence GGGTTAAAACATCTGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062025293_1062025303 29 Left 1062025293 9:134337470-134337492 CCTTGGACCAGATGTTTTAACCC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1062025303 9:134337522-134337544 GGTATCCCTGACCCCAGTCTGGG No data
1062025293_1062025302 28 Left 1062025293 9:134337470-134337492 CCTTGGACCAGATGTTTTAACCC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1062025302 9:134337521-134337543 AGGTATCCCTGACCCCAGTCTGG No data
1062025293_1062025304 30 Left 1062025293 9:134337470-134337492 CCTTGGACCAGATGTTTTAACCC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1062025304 9:134337523-134337545 GTATCCCTGACCCCAGTCTGGGG No data
1062025293_1062025300 8 Left 1062025293 9:134337470-134337492 CCTTGGACCAGATGTTTTAACCC 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1062025300 9:134337501-134337523 CCTTAGTTCTCTTACCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062025293 Original CRISPR GGGTTAAAACATCTGGTCCA AGG (reversed) Intronic
902881118 1:19372392-19372414 TGGTCAGAACATCTGGTCCCAGG + Intronic
903276926 1:22228316-22228338 GAGGTAAAGCATCTTGTCCAAGG + Intergenic
904897345 1:33826813-33826835 GGGATTAAACAGCTGCTCCAAGG - Intronic
906522140 1:46473945-46473967 GGGTTAAAATATGTGATCCAAGG + Intergenic
907724852 1:57010189-57010211 AGATTAAAGCATCTGGACCATGG + Intronic
907736288 1:57115869-57115891 GGGTTGAAACATCTCTTCAAAGG + Intronic
910692886 1:89982844-89982866 GGGTTATAACATTAAGTCCATGG + Intergenic
912019973 1:105096170-105096192 GGTTTAAAAAATCTGGTTCGTGG + Intergenic
913270596 1:117089322-117089344 GCTTTAAAACATATGGTCTAGGG + Intronic
919816515 1:201444131-201444153 GGGTCACAACATTTAGTCCATGG - Intergenic
922722822 1:227907290-227907312 GGGGTCAACGATCTGGTCCAAGG + Intergenic
924913845 1:248544622-248544644 TTGTTAATCCATCTGGTCCAGGG + Intergenic
1065737701 10:28769496-28769518 GAAGAAAAACATCTGGTCCAAGG - Intergenic
1070750318 10:78960232-78960254 GGGTTAAAGCAACTCGTCCAAGG - Intergenic
1071466814 10:85948309-85948331 AGGATAAAACATCTAGTCCAAGG + Intronic
1071794037 10:88986376-88986398 GGGTGAAAACATCTGTTCTGTGG - Intronic
1073581613 10:104672084-104672106 TGGTGAAACCATCAGGTCCAGGG + Intronic
1073653566 10:105387741-105387763 GGTTTAAACCATGTGGTCTATGG + Intergenic
1075770343 10:124929303-124929325 GAGGTGAAACATCTCGTCCAGGG - Intergenic
1079454120 11:20622562-20622584 GGGTTTAAATATCTCGTTCAAGG - Intronic
1080244901 11:30168983-30169005 GGGTGCAAACCTCTGGGCCAGGG + Intergenic
1081097006 11:38949205-38949227 TGGTTCAAACATCTGGCCTAGGG + Intergenic
1081226889 11:40534969-40534991 GGGTCTAAACATATGGTCCATGG + Intronic
1087256299 11:95958117-95958139 GGGTTAGAACTTCAGGTGCAAGG + Intergenic
1089321363 11:117628864-117628886 GAGATAAAGCATCTTGTCCAAGG + Intronic
1090930614 11:131295167-131295189 GGGTTAAAACCCCTGTTCCATGG - Intergenic
1092162940 12:6325971-6325993 GGGTAAAAATATCTGGTTCATGG + Intronic
1092495530 12:8990056-8990078 GAATTTAAACAGCTGGTCCAAGG - Intronic
1092919274 12:13216118-13216140 GGCTTAAAATAGCTGCTCCAGGG - Exonic
1094033187 12:26037261-26037283 TGCTTAAAATATCTGGACCATGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1098873356 12:75841332-75841354 GGTTTAAAACAACTTGCCCAGGG + Intergenic
1100316476 12:93449359-93449381 GTTTGAAAACATCTGTTCCAGGG - Intergenic
1103822410 12:123709641-123709663 GGCTAAAAACATCTATTCCAGGG - Intergenic
1104885057 12:132102383-132102405 GTGCTAAAACATCAGTTCCACGG - Intronic
1108150753 13:47531387-47531409 GGGTTTCACCATCTTGTCCAGGG - Intergenic
1108964752 13:56283910-56283932 GGGTTTAAACATCTTGCCAATGG + Intergenic
1109061535 13:57628171-57628193 GGGTTAATACCTCTGTCCCAAGG - Intergenic
1109923140 13:69096428-69096450 GGTTTAAAACATTTGGGCAATGG - Intergenic
1110112206 13:71762118-71762140 GAGGTAAAATAACTGGTCCAAGG + Intronic
1111091176 13:83450147-83450169 GGGTTAAAACAGCAGGTTAAAGG + Intergenic
1111440398 13:88275442-88275464 AGTTTAAAACATATGGTCCATGG - Intergenic
1111570519 13:90078234-90078256 GGATTAAAAAATATGGTACACGG - Intergenic
1114153053 14:20066614-20066636 CTGTGAAACCATCTGGTCCAGGG - Intergenic
1114334284 14:21671913-21671935 GAGTCAAATCAACTGGTCCAAGG + Intergenic
1115961680 14:38840981-38841003 GGGTTAAAAGAACTAGTACATGG + Intergenic
1120397926 14:83992009-83992031 GTGGTCAAACATCTTGTCCAAGG + Intergenic
1123884793 15:24715458-24715480 TTGTTAAACCATCTGGTCCTGGG + Intergenic
1124608359 15:31189823-31189845 GGTAGAATACATCTGGTCCAGGG - Intergenic
1124857663 15:33406327-33406349 AGGGTCAAACATTTGGTCCAAGG - Intronic
1136633513 16:31504090-31504112 GGGTTAAACCATATTGGCCAGGG + Intronic
1141692729 16:85605731-85605753 GGGTTAACACGTCTGGCCCCAGG + Intergenic
1146832259 17:36080350-36080372 GGGTTAAAACAACTTGTCCAAGG - Intergenic
1146846750 17:36186673-36186695 GAGTTAAAACAACTTGTCCATGG - Intronic
1148848696 17:50543653-50543675 GGGTTCAAAGTTCTGCTCCAAGG + Exonic
1151378191 17:73706058-73706080 GAGGTAAAATAACTGGTCCAAGG - Intergenic
1151874281 17:76857617-76857639 GCGGTGAAACATCTTGTCCAAGG - Intergenic
1152243722 17:79174149-79174171 GGGTGAAAACACCTGGTAGAAGG + Intronic
1153191016 18:2538693-2538715 GGATTAAGACCTCTGGTCCACGG + Exonic
1155277631 18:24204057-24204079 GGGTTAAAACTGCTGGGTCAAGG + Intronic
1157107569 18:44788993-44789015 GGGTTTTAACATGTTGTCCAGGG + Intronic
1158091549 18:53720229-53720251 GTTTGAAAACAACTGGTCCAGGG - Intergenic
1160410700 18:78673711-78673733 GGTTTAGACCGTCTGGTCCATGG + Intergenic
1160570691 18:79815784-79815806 GGGTTAGAACAGCTGCTTCAGGG - Intergenic
1161718839 19:5892321-5892343 GGGCTAAGAGATCTGGTACAGGG + Exonic
1163720145 19:18894896-18894918 GGGTGACACCAGCTGGTCCACGG + Intronic
1164136910 19:22424577-22424599 GGGTGAAAACAATTGGTTCAGGG - Intronic
1164161994 19:22633185-22633207 GGGTGAAAACAATTGGTTCAGGG + Intergenic
927589404 2:24340286-24340308 GGGTTATACCATCTTGGCCAGGG - Intronic
927727978 2:25442788-25442810 AGGTTAAATCATCTTGCCCAAGG - Intronic
927785792 2:25973818-25973840 GGGGTAGAACAGCTGGTGCAGGG + Intronic
927849041 2:26487460-26487482 AGGCTTAAACAGCTGGTCCAGGG - Intronic
930037515 2:47096277-47096299 GAGTAAACCCATCTGGTCCAAGG + Intronic
930351142 2:50256273-50256295 GGGTAAAAACGTTTGGTACATGG - Intronic
931189682 2:59988213-59988235 TGATTAAAACATCTGGCCAAGGG + Intergenic
933573160 2:84036928-84036950 GGGATTAAACAACTTGTCCATGG + Intergenic
936668106 2:114621857-114621879 TGATTCAAACAGCTGGTCCAGGG + Intronic
937044231 2:118842844-118842866 GGGAGAAAGCATCTGCTCCAAGG - Exonic
945389770 2:209250218-209250240 GTGTGAAGTCATCTGGTCCAGGG - Intergenic
945682734 2:212933551-212933573 GTGGTAAAAAATCTGGTCCTTGG + Intergenic
1169755570 20:9039787-9039809 GGCTTAAAACAAATGGGCCATGG - Intergenic
1174851454 20:53999401-53999423 AGGTTTAAACATCATGTCCAAGG + Intronic
1181086632 22:20442579-20442601 GTGTTGAAACATCCTGTCCATGG + Intronic
1181758489 22:25041561-25041583 TGGTTTAAACATCTAGTCTAGGG + Intronic
1183446885 22:37862979-37863001 GGATTCAAACCTCTGCTCCAAGG - Exonic
949251618 3:1991663-1991685 GGTTTAAAATATCGGGCCCAAGG - Intergenic
949561828 3:5209931-5209953 GGGTAAGACCATCTGTTCCAGGG - Intronic
951160265 3:19410896-19410918 TGGTAAACTCATCTGGTCCAGGG - Intronic
952047308 3:29338464-29338486 GAGCTAAAACTTCTTGTCCAGGG - Intronic
956785453 3:72638502-72638524 GGGTTCAAGCATCAGATCCAGGG - Intergenic
958497097 3:94859271-94859293 CTGTTAATCCATCTGGTCCAGGG + Intergenic
962058769 3:131903200-131903222 GGCTTAAAGAATTTGGTCCAAGG + Intronic
962685126 3:137840299-137840321 GGGTGAATACTTTTGGTCCATGG + Intergenic
965703666 3:171484133-171484155 TCTTTAAAACATCAGGTCCATGG - Intergenic
969164981 4:5299821-5299843 CTGTTAATCCATCTGGTCCAGGG - Intronic
971058501 4:22940402-22940424 TCGTTAAAACATCTATTCCATGG - Intergenic
974482689 4:62466871-62466893 TGGTAAATACATCTGGTCCATGG + Intergenic
974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG + Intergenic
974599380 4:64057106-64057128 CTGTGAAACCATCTGGTCCAGGG + Intergenic
975344753 4:73281468-73281490 GGGCTAAAAACCCTGGTCCATGG - Intergenic
978635002 4:110794125-110794147 GTGTTAAAACATAAGATCCAGGG - Intergenic
979843649 4:125479419-125479441 TGGTTAATACATATGATCCAGGG - Intronic
980091380 4:128446707-128446729 AGGTTAAAATAACTGGCCCAAGG - Intergenic
982145268 4:152381541-152381563 GGGTTAAAACTTGTTGACCAGGG + Intronic
984539055 4:181014300-181014322 GAGTTTAAACAACTTGTCCAAGG - Intergenic
987669978 5:20994149-20994171 CTGTGAATACATCTGGTCCAGGG - Intergenic
994031246 5:95145999-95146021 CTGTTAATCCATCTGGTCCATGG + Intronic
999288880 5:150410418-150410440 CGGGTAAAACATCTGCTCCAAGG + Intronic
999941629 5:156549227-156549249 GAGGGAAAACATCTGTTCCATGG + Intronic
1000297204 5:159922308-159922330 GAGGTAAAACTTCTGGTCCAAGG + Intronic
1004023619 6:11797567-11797589 GTGTTTAAATAACTGGTCCAAGG + Intronic
1011939204 6:92821754-92821776 GGGTTTCACCATGTGGTCCAGGG - Intergenic
1015221131 6:130804351-130804373 CAGTGAAACCATCTGGTCCAAGG + Intergenic
1025066012 7:55856691-55856713 GGATTAAAAAATGTGGTACATGG - Intronic
1025634685 7:63312376-63312398 CTGTGAAAACATCTGGTCCTGGG - Intergenic
1025648011 7:63435794-63435816 CTGTGAAAACATCTGGTCCTGGG + Intergenic
1028895085 7:96031943-96031965 GGGTTACAACATCTTGTGTATGG + Intronic
1029299485 7:99568146-99568168 GTATTAAAAAATCTGGTCTATGG - Intronic
1030339426 7:108360015-108360037 TGCTTAAAACATCTGGAACATGG - Intronic
1033455820 7:141502438-141502460 AGGTTAAAACAGCTGGTCATAGG + Intergenic
1036392696 8:8338203-8338225 AGGTTAAAACACATGGTACATGG - Intronic
1040495329 8:47960738-47960760 GGGTCAGACCATCTGGACCAAGG + Intronic
1043700366 8:83279813-83279835 CAGTAAAAACATCAGGTCCAGGG + Intergenic
1044146169 8:88716844-88716866 GTGTGAACACATCTGGTCCAGGG - Intergenic
1044522663 8:93217456-93217478 AGGTGAACACATCTGGTGCATGG - Intergenic
1046678348 8:117137976-117137998 GGGTAAAAAAATATGGTTCATGG - Intronic
1051286506 9:15502808-15502830 GGTTTAAAATATCTAGTACATGG + Intronic
1052012445 9:23426501-23426523 GGGTTAAAACATGTGCTTCTGGG + Intergenic
1056460916 9:86809005-86809027 AGGTTAAAATAACTCGTCCAAGG - Intergenic
1057482175 9:95453552-95453574 GGGTGCAAACATGTGCTCCAGGG + Exonic
1058916483 9:109571511-109571533 CTGTGAAACCATCTGGTCCAGGG - Intergenic
1062025293 9:134337470-134337492 GGGTTAAAACATCTGGTCCAAGG - Intronic
1186559431 X:10595119-10595141 GAGTTAAAGCATCTTCTCCAGGG + Intronic
1193045101 X:77045270-77045292 CTGTAAAACCATCTGGTCCAGGG - Intergenic
1194245265 X:91503311-91503333 CTGTGAATACATCTGGTCCAGGG - Intergenic
1194984829 X:100479079-100479101 GGCTTATGACATCTGGTCCAGGG + Intergenic
1195672115 X:107478574-107478596 AGTTTCAAGCATCTGGTCCAGGG + Intergenic
1196174743 X:112628264-112628286 GTGTTTAAGCATCTGGGCCATGG + Intergenic
1196710978 X:118762466-118762488 GAGCTAAAACAACTGGACCAAGG - Intronic
1197090497 X:122530544-122530566 CTGTAAAATCATCTGGTCCAGGG - Intergenic
1197382368 X:125760697-125760719 CGGTGAAAACATCAGGTCCTGGG + Intergenic
1199820307 X:151439036-151439058 GGGGTTAAACAGCTTGTCCATGG + Intergenic
1200564237 Y:4744622-4744644 CTGTGAATACATCTGGTCCAGGG - Intergenic
1201485922 Y:14494693-14494715 GGCTTAAAACACCTGGACTACGG + Intergenic