ID: 1062026398

View in Genome Browser
Species Human (GRCh38)
Location 9:134342651-134342673
Sequence GAGGCCCCTGTGGTTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062026389_1062026398 11 Left 1062026389 9:134342617-134342639 CCAGGCAGGTGGTGGGGCTGCGG 0: 1
1: 2
2: 7
3: 74
4: 599
Right 1062026398 9:134342651-134342673 GAGGCCCCTGTGGTTCCCACAGG No data
1062026388_1062026398 12 Left 1062026388 9:134342616-134342638 CCCAGGCAGGTGGTGGGGCTGCG 0: 1
1: 2
2: 2
3: 40
4: 420
Right 1062026398 9:134342651-134342673 GAGGCCCCTGTGGTTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062026398 Original CRISPR GAGGCCCCTGTGGTTCCCAC AGG Intronic
No off target data available for this crispr