ID: 1062027095

View in Genome Browser
Species Human (GRCh38)
Location 9:134345573-134345595
Sequence CACCCACTAGGTGTTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062027091_1062027095 3 Left 1062027091 9:134345547-134345569 CCGACATCACATGTCTGGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 180
Right 1062027095 9:134345573-134345595 CACCCACTAGGTGTTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062027095 Original CRISPR CACCCACTAGGTGTTCATCC AGG Intronic
No off target data available for this crispr