ID: 1062032172

View in Genome Browser
Species Human (GRCh38)
Location 9:134366610-134366632
Sequence GCCCCTCCACTAGTGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062032164_1062032172 6 Left 1062032164 9:134366581-134366603 CCCAGCCAGGGCTGGGGCAGGGA No data
Right 1062032172 9:134366610-134366632 GCCCCTCCACTAGTGGGCTTTGG No data
1062032155_1062032172 27 Left 1062032155 9:134366560-134366582 CCTGGGGACAGCACCACAGGGCC No data
Right 1062032172 9:134366610-134366632 GCCCCTCCACTAGTGGGCTTTGG No data
1062032158_1062032172 14 Left 1062032158 9:134366573-134366595 CCACAGGGCCCAGCCAGGGCTGG No data
Right 1062032172 9:134366610-134366632 GCCCCTCCACTAGTGGGCTTTGG No data
1062032165_1062032172 5 Left 1062032165 9:134366582-134366604 CCAGCCAGGGCTGGGGCAGGGAG No data
Right 1062032172 9:134366610-134366632 GCCCCTCCACTAGTGGGCTTTGG No data
1062032167_1062032172 1 Left 1062032167 9:134366586-134366608 CCAGGGCTGGGGCAGGGAGGAAG No data
Right 1062032172 9:134366610-134366632 GCCCCTCCACTAGTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062032172 Original CRISPR GCCCCTCCACTAGTGGGCTT TGG Intronic