ID: 1062035891

View in Genome Browser
Species Human (GRCh38)
Location 9:134382372-134382394
Sequence CTGGGGAGACAGTGGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062035874_1062035891 20 Left 1062035874 9:134382329-134382351 CCCAAGCTCAGGCCTTTAGCACC 0: 1
1: 0
2: 1
3: 21
4: 216
Right 1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG No data
1062035882_1062035891 -1 Left 1062035882 9:134382350-134382372 CCTTGGCTGGGAGGAGTGAGGCC 0: 1
1: 0
2: 5
3: 45
4: 372
Right 1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG No data
1062035875_1062035891 19 Left 1062035875 9:134382330-134382352 CCAAGCTCAGGCCTTTAGCACCT 0: 1
1: 0
2: 2
3: 29
4: 288
Right 1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG No data
1062035879_1062035891 8 Left 1062035879 9:134382341-134382363 CCTTTAGCACCTTGGCTGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 158
Right 1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062035891 Original CRISPR CTGGGGAGACAGTGGGGGCC AGG Intronic
No off target data available for this crispr