ID: 1062037057

View in Genome Browser
Species Human (GRCh38)
Location 9:134387052-134387074
Sequence CCACAGCAGCGGCCCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 421}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062037057_1062037072 14 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037072 9:134387089-134387111 GGGTGAGAGGGGAGACATAGGGG No data
1062037057_1062037067 1 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037067 9:134387076-134387098 TGCGGTGTCGGGTGGGTGAGAGG No data
1062037057_1062037069 3 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037069 9:134387078-134387100 CGGTGTCGGGTGGGTGAGAGGGG No data
1062037057_1062037065 -7 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037065 9:134387068-134387090 GCTGTGGCTGCGGTGTCGGGTGG No data
1062037057_1062037071 13 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037071 9:134387088-134387110 TGGGTGAGAGGGGAGACATAGGG No data
1062037057_1062037070 12 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037070 9:134387087-134387109 GTGGGTGAGAGGGGAGACATAGG No data
1062037057_1062037064 -10 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037064 9:134387065-134387087 GCTGCTGTGGCTGCGGTGTCGGG No data
1062037057_1062037068 2 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037068 9:134387077-134387099 GCGGTGTCGGGTGGGTGAGAGGG No data
1062037057_1062037066 -6 Left 1062037057 9:134387052-134387074 CCTGCCCTGGGCCGCTGCTGTGG 0: 1
1: 1
2: 3
3: 52
4: 421
Right 1062037066 9:134387069-134387091 CTGTGGCTGCGGTGTCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062037057 Original CRISPR CCACAGCAGCGGCCCAGGGC AGG (reversed) Intronic
900385201 1:2407430-2407452 AGACAGCCTCGGCCCAGGGCCGG + Intronic
900534216 1:3169061-3169083 CCGCAGCAGCGGCACAGCACAGG - Intronic
900564922 1:3327490-3327512 CAACGGCGGCGGCCCCGGGCAGG + Intronic
900620442 1:3584621-3584643 CCACACCAGAGTCCCAGGGCAGG + Intronic
900653346 1:3742157-3742179 CCCCACCAGGGTCCCAGGGCCGG - Intergenic
900658117 1:3770211-3770233 CCACAGCAGGAGCCCAGCCCCGG + Intronic
900978332 1:6031597-6031619 CCACTGCACCCGGCCAGGGCTGG - Intronic
901049781 1:6420295-6420317 CCCCTGCTGCGGCCCAGGGCGGG - Intronic
901689229 1:10961606-10961628 CCTCAGCAGCAGCACAGGGCTGG + Intronic
901960815 1:12825237-12825259 TCAAAGCAGCGGCTCAGGGCAGG + Exonic
901967412 1:12879839-12879861 TCAAAGCAGCGGCTCAGGGCAGG + Exonic
901975209 1:12938970-12938992 TCAAAGCAGCGGCTCAGGGCAGG + Exonic
901982812 1:13050103-13050125 TCAAAGCAGCGGCTCAGGGCAGG + Intronic
901986210 1:13077235-13077257 TCAAAGCAGCGGCTCAGGGCAGG - Exonic
901995602 1:13149532-13149554 TCAAAGCAGCGGCTCAGGGCAGG + Intergenic
901999277 1:13178815-13178837 TCAAAGCAGCGGCTCAGGGCAGG - Intergenic
902009966 1:13262794-13262816 TCAAAGCAGCGGCTCAGGGCAGG - Exonic
902017762 1:13321947-13321969 TCAAAGCAGCGGCTCAGGGCAGG - Exonic
902030826 1:13420941-13420963 TCAAAGCAGCGGCTCAGGGCAGG - Exonic
902416673 1:16243828-16243850 CCAGTGCAGCCACCCAGGGCTGG - Intergenic
902545377 1:17186446-17186468 CCAGGGCAGAGGGCCAGGGCAGG + Intergenic
902876847 1:19345528-19345550 CCACAGCAGCAGCCCTTGGCAGG + Intronic
902988508 1:20170481-20170503 GCACAGCACCGGCACTGGGCGGG + Intronic
903144377 1:21361300-21361322 CGACAGCAGAGGCCAAGGCCTGG + Intergenic
903263361 1:22142940-22142962 CCGCAGCCGCTGCCCCGGGCCGG - Exonic
903265357 1:22154726-22154748 CCATAGCAGCTGCAGAGGGCTGG - Intergenic
903369823 1:22828102-22828124 GCCCATCAGTGGCCCAGGGCTGG - Intronic
903619647 1:24688736-24688758 CCACAGCAGGCACCCAGGCCCGG - Intergenic
903742606 1:25566950-25566972 TGACAGCAGCGGCACAGAGCAGG + Exonic
905434807 1:37948999-37949021 CCACAGCCAGGGCCCAGTGCAGG + Intergenic
905918093 1:41699727-41699749 CCTCAATAGGGGCCCAGGGCAGG - Intronic
906214295 1:44030306-44030328 CCACCGCAGGGGCCGGGGGCGGG - Intronic
907326516 1:53641922-53641944 ACAGAGCAGCGGCCCTGGGATGG - Intronic
907982171 1:59494390-59494412 CAGGAGCAGAGGCCCAGGGCTGG + Intronic
910516736 1:88069872-88069894 CCACAGCAGAAGCCCAGTGTGGG + Intergenic
911268205 1:95768556-95768578 CCAAAGCAGGGGTCCAGGGCAGG - Intergenic
912701026 1:111878411-111878433 CCACAGCAGGTGCCCTGGACAGG - Intronic
912797121 1:112700017-112700039 CCACAGCCCCTGCCTAGGGCAGG + Intronic
912822959 1:112882270-112882292 CCACAGCAGTGGCCAAGCCCTGG + Intergenic
915041342 1:152970585-152970607 CCACACCAAGTGCCCAGGGCAGG + Intergenic
915320068 1:155051585-155051607 CCAGGACAGCGGACCAGGGCGGG - Intronic
915564707 1:156706939-156706961 CCAGGGCAGGGACCCAGGGCTGG - Intergenic
915634718 1:157178166-157178188 CCAGAGCAGGGCCCCATGGCAGG - Intergenic
916172091 1:162009282-162009304 CCACACCTGCGGCCCAGCTCTGG + Intronic
917556131 1:176090553-176090575 TAACAGCAGCAGCACAGGGCAGG + Intronic
922699503 1:227750609-227750631 CCTCAGCAGCGAGCCAGGGCAGG - Intronic
922719176 1:227891643-227891665 CAGCCGCAGTGGCCCAGGGCAGG + Intergenic
924370889 1:243348537-243348559 CCCCAGCAGCAGGGCAGGGCGGG + Intronic
1064940863 10:20734098-20734120 CCACAGAGGAGGCCCAGGTCAGG - Intergenic
1065470893 10:26080852-26080874 CCCCAGCAGCAGCCCAGAGCTGG - Intronic
1065993394 10:31033365-31033387 CCACGGCAGATGGCCAGGGCAGG + Intergenic
1066064216 10:31750506-31750528 GCCCAGCGGCTGCCCAGGGCCGG - Intergenic
1066456994 10:35581168-35581190 TCACATCAGCAGCCAAGGGCAGG - Intergenic
1067051774 10:43025540-43025562 CCACAGCAGGTGCCAGGGGCAGG - Intergenic
1067290480 10:44935920-44935942 CCACAGAGGCTGCCCAGGGGTGG + Exonic
1068536845 10:58249331-58249353 CCACCCCAGCCTCCCAGGGCTGG + Intronic
1069043682 10:63720982-63721004 CCACACAAGGGGACCAGGGCTGG - Intergenic
1069901995 10:71711554-71711576 CCACAGGACCCTCCCAGGGCTGG - Intronic
1069908655 10:71746869-71746891 CCCCAGCAGCGGCCCCGTGACGG + Intronic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070676032 10:78411902-78411924 CCACAGCCGAGTGCCAGGGCAGG + Intergenic
1070934224 10:80280933-80280955 CCACAGCTGAGGCCCAGGATGGG + Intronic
1071106567 10:82104232-82104254 CCACAGCAGAAGCCCAGGTTAGG + Intronic
1072248138 10:93560941-93560963 ACACACTAGGGGCCCAGGGCAGG - Intergenic
1072675865 10:97465584-97465606 CAAGAGCAGCGGCCCTGGCCGGG + Intronic
1073491373 10:103855410-103855432 CCACAGGTCCGGCCCAGGGACGG + Intronic
1073762772 10:106648757-106648779 CCAGGGCAGGGGCCCAGGGGTGG - Intronic
1074772564 10:116743013-116743035 CCAGGGGAGCGGCCCTGGGCCGG + Intergenic
1074866354 10:117546387-117546409 GCACAGCAGGGTCCCTGGGCGGG + Intronic
1075159331 10:120009602-120009624 GCACAGTAGCTACCCAGGGCAGG + Intergenic
1075468867 10:122672898-122672920 GCACAGCAGCGGCCAAGCGAAGG - Intergenic
1075609546 10:123841295-123841317 CGACCGCGGCGGCTCAGGGCTGG - Intronic
1076175018 10:128361696-128361718 CCAGGGCAGTGGCCCAGGGGAGG + Intergenic
1076461866 10:130653321-130653343 GCACAGCAGAGGCCCTGGCCGGG - Intergenic
1076549422 10:131268110-131268132 CCACTGCAGCTGCTCAAGGCCGG - Intronic
1076680669 10:132169710-132169732 CCACAGCCGCTGCCCACTGCAGG - Intronic
1076804777 10:132849884-132849906 CCGCAGCAGCGGCTCTGGCCAGG - Intronic
1076877624 10:133224259-133224281 CCACGGCCGGGGCCCAGGGCCGG - Intronic
1077028284 11:451379-451401 CGACAGCTGCGACCCTGGGCTGG + Intronic
1077133948 11:989355-989377 CCACAGAAGCCGCGCAGGACGGG - Intronic
1077148048 11:1054604-1054626 CAACAGCTGCGGGCCAGGGCGGG - Intergenic
1077307647 11:1875156-1875178 CCACGGCACCAGCCCAGTGCTGG - Intronic
1077367082 11:2165621-2165643 CCCCAGCAGAGGGGCAGGGCTGG - Intronic
1077728501 11:4702352-4702374 CCACAGCAGCTGACCATGCCTGG - Intergenic
1078142429 11:8702055-8702077 CAACTGCAGTGGCCCAGGGCTGG - Intronic
1078218518 11:9332230-9332252 CCACCGCACCGGGCCAGGACTGG + Intergenic
1079361999 11:19777277-19777299 GCGCAGCAGCGGCCCCGGGGCGG + Intronic
1080152965 11:29075877-29075899 CCACAGCACCAGCCCGGAGCCGG - Intergenic
1081534091 11:43984908-43984930 CCAGAGGAGTGGCCCTGGGCAGG + Intergenic
1082792345 11:57355087-57355109 CCACTGAGGCAGCCCAGGGCAGG + Intronic
1083266618 11:61549961-61549983 TTACAGCCGCGGGCCAGGGCTGG - Intronic
1083340294 11:61954963-61954985 CCTCAGGAGGGGCCCTGGGCTGG + Intronic
1083883443 11:65559154-65559176 GCACAGCAGAGCCCCAGGGCAGG + Intergenic
1083922513 11:65788211-65788233 CCACAGCGGAGGGCCAGGCCCGG + Intronic
1084030400 11:66477594-66477616 CCACTGCAGGGGCCCTGCGCAGG - Intergenic
1084122160 11:67075976-67075998 ACAAAGCAGGGGTCCAGGGCTGG - Intergenic
1084192827 11:67506605-67506627 CCCCAGCAGGGGCACAGGCCTGG - Exonic
1084364413 11:68688191-68688213 CCACAGCTGCAGCCCAAGCCTGG + Intronic
1086421089 11:86638071-86638093 CCACAGGAGCCCCCCAGGCCTGG + Intronic
1089341997 11:117764220-117764242 CCCCAGCAGTGCCCCAGAGCAGG - Intronic
1091208245 11:133835129-133835151 ACACAGCACGGGCCCAGTGCTGG + Intergenic
1091404326 12:199545-199567 CCACTGCCGCCGCCCAGGGAAGG - Intronic
1092184855 12:6471096-6471118 CCAGAGCAGGGCACCAGGGCTGG - Intergenic
1092630424 12:10370576-10370598 CCACAGAAGCGACTAAGGGCAGG - Intergenic
1096500855 12:52063163-52063185 ACACAGCAGGGGCCCAGGAGTGG - Intergenic
1096882467 12:54684260-54684282 CCACAGCACCGGTCCTGGGCAGG - Intergenic
1098161203 12:67649224-67649246 CCACAGGGGCTGCCCAGGGCCGG - Intronic
1100186460 12:92145288-92145310 CCTCGGCAGCGCCCCGGGGCCGG - Intronic
1101000985 12:100357036-100357058 CCCCAGCTGCAGCCCAGGGAGGG + Intergenic
1101378550 12:104192136-104192158 CTACAGCAGGGGCTCAGGGGAGG + Intergenic
1101841838 12:108333190-108333212 CCTCAGCAGGAACCCAGGGCTGG + Intronic
1102179256 12:110899605-110899627 CCACTGCACCTGGCCAGGGCAGG + Intronic
1102884097 12:116508671-116508693 CCTGAGCAGCGGCCCTGGGAGGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103898906 12:124293300-124293322 CCACAATAGCTACCCAGGGCAGG - Intronic
1103956919 12:124582479-124582501 CCACAGCAGCTCCCCAGGGCAGG - Intergenic
1104485543 12:129148756-129148778 CCACAGCTGCATGCCAGGGCTGG + Intronic
1104860492 12:131921007-131921029 CCACGGCAGCGGCCCAGGGGTGG - Intronic
1104925429 12:132311618-132311640 CCACGGCAGCTGCCCTGGCCTGG - Intronic
1105014403 12:132777386-132777408 CCACAGCATCAGCCCCGCGCCGG + Intronic
1105016302 12:132788034-132788056 CCACAGCTGCAGGCCTGGGCTGG - Intronic
1107397236 13:40030522-40030544 CCACATCTGCGGCCTAGAGCAGG - Intergenic
1113494154 13:110714394-110714416 CCGCAGCGGCGGCCCTCGGCAGG + Intronic
1113577956 13:111407588-111407610 CCTCGGCAGGGGCACAGGGCCGG - Intergenic
1113750337 13:112772662-112772684 CATTAGCAGCTGCCCAGGGCTGG - Intronic
1113762510 13:112859502-112859524 CCACAGCAGCCACCCACTGCGGG - Intronic
1113964088 13:114142692-114142714 CCACAGCGGAGGCCTCGGGCAGG - Intergenic
1114272198 14:21107705-21107727 CAGCAGCAGCAGCCCAGGTCAGG - Intergenic
1114630356 14:24155521-24155543 CCACAGTAGCTGCCCTGGGCAGG - Intronic
1116916687 14:50532369-50532391 CGCCAGCCGGGGCCCAGGGCCGG + Intronic
1117177915 14:53164180-53164202 CCACAGCAGAGGCCTAAGCCAGG + Intergenic
1118332248 14:64823676-64823698 CCAGTGCAGCTGCCCCGGGCTGG - Intronic
1118867996 14:69718315-69718337 TCCCAGCAGCGGCCCAGGGTGGG + Intergenic
1119296542 14:73537762-73537784 GCACAGCAGCCGCCCGGGGTCGG - Exonic
1119300786 14:73569767-73569789 GCACAGCAGCCGCCCGGGGTCGG - Exonic
1121413855 14:93765323-93765345 CCTCAGCGGCAGCACAGGGCTGG - Intronic
1121677526 14:95766206-95766228 CCATAGAAGAGTCCCAGGGCTGG - Intergenic
1122144132 14:99679121-99679143 CCACAGCAGGGTCCCAGAGCTGG - Exonic
1122263320 14:100535296-100535318 CCAAGGCTGCCGCCCAGGGCAGG + Intergenic
1122771466 14:104099750-104099772 AAACAGCAGGGGGCCAGGGCAGG - Intronic
1122805285 14:104253382-104253404 CCACAGCAGAGGGCCTGGCCTGG - Intergenic
1123070887 14:105642049-105642071 CCAAAGCTGGTGCCCAGGGCAGG - Intergenic
1123071088 14:105642859-105642881 CAGCAGCAGCTGCCCTGGGCTGG - Intergenic
1123090548 14:105740333-105740355 CCAAAGCTGGTGCCCAGGGCGGG - Intergenic
1123090748 14:105741129-105741151 CAGCAGCAGCTGCCCTGGGCTGG - Intergenic
1123096179 14:105768083-105768105 CCAAAGCTGGTGCCCAGGGCGGG - Intergenic
1123096383 14:105768893-105768915 CAGCAGCAGCTGCCCTGGGCTGG - Intergenic
1123192348 14:106583384-106583406 AGACAGGAGCAGCCCAGGGCAGG - Intergenic
1124395172 15:29294461-29294483 CCACTGTGGAGGCCCAGGGCGGG - Intronic
1124629559 15:31328586-31328608 GCCCCGCACCGGCCCAGGGCAGG - Intronic
1124972022 15:34496790-34496812 CCGCAGCCCAGGCCCAGGGCTGG - Intergenic
1125674301 15:41494208-41494230 CCGCTCCGGCGGCCCAGGGCTGG - Exonic
1126795567 15:52258075-52258097 TCACAGCTGGGGCCAAGGGCAGG + Intronic
1128242135 15:66108272-66108294 CCACAGCAGTGGGGCAAGGCAGG + Intronic
1129230847 15:74196496-74196518 CAACAGCCGCCGCCCTGGGCTGG + Intronic
1129445920 15:75617868-75617890 CCACCGCATCTGGCCAGGGCAGG + Intronic
1129464480 15:75716312-75716334 CCACAGCCACTGCCCAGAGCGGG - Intergenic
1129605284 15:77021936-77021958 CCCCAGAAGCTGCACAGGGCAGG + Intronic
1129720767 15:77876700-77876722 CCACAGCCACTGCCCAGAGCGGG + Intergenic
1129823513 15:78620080-78620102 TCCCAGCGGCGGGCCAGGGCCGG + Intronic
1129869177 15:78929805-78929827 CCACAGCCGAGCCCCTGGGCAGG + Intronic
1131107933 15:89747356-89747378 CCAGAGCAGCGACCCTTGGCCGG - Intergenic
1131340863 15:91599297-91599319 CCACAGTGGCTGCCCAGGGCTGG - Intergenic
1132548264 16:543565-543587 CCACAGCAGCGGGCACGGGCAGG - Intronic
1132766312 16:1536115-1536137 GCAGAGCTGCGGCCAAGGGCCGG - Intronic
1132831297 16:1929699-1929721 CCCCAGCACCGGCCCAAGGGCGG + Intergenic
1133014369 16:2932580-2932602 CCACCCCAGGTGCCCAGGGCAGG - Intronic
1133138566 16:3728946-3728968 CCCCAGCAGCAGCCCATGCCAGG - Exonic
1133254996 16:4511306-4511328 AGAGAGCAGAGGCCCAGGGCGGG + Exonic
1134066244 16:11230294-11230316 CCAGAGCAGAGGCTCAGGGAGGG - Intergenic
1137404310 16:48177759-48177781 TCACAGCAGCATCCCTGGGCAGG + Intronic
1137410445 16:48223433-48223455 CCACATTAGGGGCACAGGGCAGG + Intronic
1139957760 16:70701245-70701267 GCCCAGCAGGGGCTCAGGGCCGG - Intronic
1141135895 16:81465335-81465357 CCACAGCAGGGCCTCAGGCCTGG - Intronic
1141421051 16:83915767-83915789 CCACAGCACCAGCCCCGGGCAGG - Exonic
1141592583 16:85078434-85078456 CAGGAGAAGCGGCCCAGGGCTGG + Exonic
1141896904 16:86964115-86964137 CCTCAGCAGCAGGCCAGGGGCGG + Intergenic
1142135397 16:88449708-88449730 CCACAGCTGCTGCCCAGCCCCGG + Intergenic
1142148654 16:88503152-88503174 CCTGAGCAGCGGCACAGGGGAGG + Intronic
1142155786 16:88532373-88532395 CCCCCGCAGGGGCCCAGAGCAGG + Intronic
1142260317 16:89039739-89039761 CCAGATCAGAGGCTCAGGGCTGG + Intergenic
1203141676 16_KI270728v1_random:1771327-1771349 CCACAGCCTCCCCCCAGGGCTGG - Intergenic
1203141693 16_KI270728v1_random:1771374-1771396 CCACAGCCTCCCCCCAGGGCTGG - Intergenic
1142969408 17:3601174-3601196 CCACAGAAACAGCCCAGGGAGGG - Intergenic
1142994848 17:3754578-3754600 GCACAGCAGCCACCCAGGGGAGG - Intronic
1143120056 17:4600761-4600783 CCTCTGCAGAGGCCCAGTGCAGG + Intronic
1144671028 17:17132657-17132679 CCAATACAGCAGCCCAGGGCAGG - Intronic
1144782653 17:17815729-17815751 CCACAGCAACAACCCATGGCAGG + Intronic
1145250943 17:21296720-21296742 CCACAGCACCGGCCACAGGCAGG - Intronic
1145778278 17:27544628-27544650 CCACAGGGGAGGCCCTGGGCTGG - Intronic
1145785968 17:27594080-27594102 CCACAGCAGCTGCCCAGCCCTGG + Intronic
1145912821 17:28552390-28552412 CCTCTGCAGCGGCCCCGGCCTGG + Exonic
1146211461 17:30946816-30946838 CTACAGCAGAGGCACATGGCAGG - Intronic
1146503388 17:33383655-33383677 CAAGAGCAGAGGCCCAGGGTGGG - Intronic
1147877938 17:43634779-43634801 CCAGAGCCGGGGCCCACGGCTGG - Intergenic
1148051051 17:44770056-44770078 CCACTGCAGGGGACCGGGGCCGG + Intronic
1148445735 17:47735863-47735885 CCCCAGCAAGGGCCCAGGGTGGG - Intronic
1148895234 17:50835663-50835685 CCACAGCAGGGGCCCGCGCCCGG - Exonic
1149384243 17:56126030-56126052 ACACAACAGCAGCCCCGGGCGGG - Intronic
1150294648 17:64001420-64001442 CCCCATCAGAGGCCCAGGGGTGG - Intronic
1150493354 17:65589301-65589323 CCAAAGCAGGGGCCCAGCACAGG + Intronic
1151334540 17:73432173-73432195 CCCCAGCAGCAGCCCTGGTCAGG + Intronic
1151671263 17:75572945-75572967 CAGCAGCAGCAGCACAGGGCAGG + Intronic
1151727861 17:75894951-75894973 CTCCAGCAGCTGCCCGGGGCGGG + Intronic
1152552676 17:81037647-81037669 GCACAGGAGCGGCCCCGGGAAGG - Intronic
1152822305 17:82443592-82443614 CCAAAGCAGGAGTCCAGGGCTGG + Exonic
1152861244 17:82698082-82698104 CCACAGCAGCGGCCCCAGGTCGG + Intronic
1156458344 18:37307200-37307222 CCAGAGCAGAGGCACAGGGCAGG - Intronic
1156469285 18:37367411-37367433 CCACTGCTGCCTCCCAGGGCTGG - Intronic
1157163489 18:45336663-45336685 CCAGAACATCTGCCCAGGGCTGG - Intronic
1157290321 18:46405430-46405452 CTACAGCAGTGGCCCAGGCAGGG + Intronic
1157598103 18:48876055-48876077 CCAGAGCAGCTGGCCAGGGCTGG - Intergenic
1157688892 18:49664776-49664798 CCACTGCAGGGTCCCAGGGATGG + Intergenic
1158548688 18:58417071-58417093 CCCCAGCAGCTGCCGAGGGGTGG + Intergenic
1159095516 18:63897326-63897348 CCACACCAGCTCCCTAGGGCTGG + Intronic
1160360177 18:78268432-78268454 CAGCAGCAGGGGCCCAGGGCTGG + Intergenic
1160536688 18:79598215-79598237 CCACAGCACCGGCCCTGGTTTGG + Intergenic
1160723484 19:607602-607624 CCAGAGCAGAGGGGCAGGGCGGG - Intronic
1161220580 19:3116288-3116310 CGACACCAGCAGCCCAGGACAGG - Intronic
1161571158 19:5031556-5031578 TCTCAGCAGCAGCCCAGCGCGGG + Intronic
1161588372 19:5117649-5117671 CCACAACAGCAGCCCAAGGACGG - Intronic
1161948778 19:7455549-7455571 CCACAGCAGCGATGCAGGCCAGG - Intronic
1161973350 19:7596022-7596044 CCTCCGCAGCGGCCCGGGCCCGG - Exonic
1162361168 19:10221374-10221396 CCCCAGGAGCGCCCCATGGCTGG - Intronic
1162754073 19:12846946-12846968 CCACGGCAGGGACCCAGGGCAGG + Intronic
1163012330 19:14433689-14433711 CCACAGTCCCGGCCCAGGGAGGG - Intronic
1163167682 19:15508952-15508974 CCAAAGAGGCGTCCCAGGGCGGG - Intronic
1163271705 19:16258526-16258548 CCACAGCCCCTGCCCAGGCCAGG + Intergenic
1163637957 19:18446121-18446143 CCACAACAGGACCCCAGGGCCGG + Intronic
1163729212 19:18940120-18940142 GGACAGCAGCTGCCCAGGACAGG - Intronic
1163755493 19:19104198-19104220 CCACTGCACCTGGCCAGGGCAGG + Intronic
1165487140 19:36102887-36102909 CCTCAACAGTGCCCCAGGGCAGG + Intronic
1165694599 19:37891409-37891431 CCACCTCAGCGTCCCAGTGCTGG + Intronic
1165960765 19:39532577-39532599 CCCCAGCAGCGTCCCGGGCCTGG - Exonic
1166297765 19:41897214-41897236 CCAAAGCAGCGGCACAAGGACGG - Intronic
1166299094 19:41904118-41904140 CCAGAGCAGCTGCCTAGTGCAGG + Intronic
1167133644 19:47603746-47603768 CCACTGCACGGGGCCAGGGCTGG + Intergenic
925064791 2:921594-921616 CCACAGCAGAGGGGCAGGGATGG - Intergenic
925067304 2:938387-938409 CCACGCCTGCGGCCGAGGGCAGG + Intergenic
925284174 2:2705211-2705233 CCTCAGCACCGGCTCAGTGCAGG + Intergenic
925592744 2:5526430-5526452 CCAATGCAGGGGCCCAGGGTTGG - Intergenic
929047706 2:37806159-37806181 CCACATCAGTTGCCTAGGGCTGG - Intergenic
929797391 2:45070669-45070691 CCACAGCAGCGGCCTGGGGGAGG - Intergenic
930338620 2:50083595-50083617 CCCCAGCAGGTGGCCAGGGCTGG + Intronic
931173345 2:59828539-59828561 GAATAGCAGTGGCCCAGGGCTGG - Intergenic
931426602 2:62177357-62177379 CCAGAGCAGCCTCCCAGGGCAGG + Intergenic
934686842 2:96327397-96327419 CCACAGCGGCGGCCCAGGGCTGG - Exonic
936117143 2:109711363-109711385 CCACTGCAGGGTCCCAGGGGAGG - Intergenic
936257259 2:110927449-110927471 CCACAGCAGGAGCACAGGACAGG - Intronic
937311055 2:120903785-120903807 GAACAGCAGCAGCCAAGGGCAGG - Intronic
937450906 2:122001365-122001387 CCACAGGAGAAGCCCTGGGCTGG + Intergenic
939512582 2:143124981-143125003 CCCAAGCAGCTGCCCAGCGCTGG - Intronic
941153833 2:161950077-161950099 TCACAGCAGAGGCTCAGGGAAGG - Intronic
941672698 2:168311461-168311483 GCACAGCTGCTGCCCAGGGATGG + Intergenic
942241233 2:173965080-173965102 CGGCGGCAGCGGCCCCGGGCTGG + Intronic
942326526 2:174781217-174781239 CCACACCAGAAGCCTAGGGCCGG + Intergenic
942458790 2:176155597-176155619 CCACAGGAGTGGGCCAGGGAAGG + Intronic
942491153 2:176490698-176490720 CCACAGCAGCCGCCCAGCGCAGG + Intergenic
944983609 2:205150026-205150048 GCCCAGCACCTGCCCAGGGCTGG - Intronic
946728740 2:222688274-222688296 TCACTGCAGTGGCCCATGGCAGG - Intronic
946984725 2:225258483-225258505 TCAGGCCAGCGGCCCAGGGCAGG - Intergenic
947751276 2:232533989-232534011 CCGCACCAGGGCCCCAGGGCTGG - Exonic
947752436 2:232539983-232540005 CTATTGCAGGGGCCCAGGGCCGG + Exonic
949026836 2:241770324-241770346 CAGCAGCAGCCACCCAGGGCAGG - Intergenic
1168816851 20:743563-743585 CAGCAGCAAAGGCCCAGGGCAGG - Intergenic
1171195513 20:23194524-23194546 CCACAGCCATGGCCCAGTGCTGG - Intergenic
1171816134 20:29787553-29787575 GCACACCAGCGGCTCACGGCCGG - Intergenic
1172134415 20:32677316-32677338 CCATCTCAGAGGCCCAGGGCCGG + Intergenic
1172269212 20:33644057-33644079 ACACAGCACCAGCCTAGGGCAGG - Intronic
1172635116 20:36405101-36405123 CCACAGAAGTGGGCAAGGGCAGG + Intronic
1173564346 20:44028325-44028347 CCCCAGCAGCAGCCTAGGGTGGG + Intronic
1173723907 20:45283618-45283640 CCACAGCTGTGGCCCATGGGAGG + Intergenic
1173844060 20:46177061-46177083 TCCCAGCAGAGGCCCTGGGCAGG - Intronic
1173868570 20:46328377-46328399 CCGCAGCCCCAGCCCAGGGCGGG - Intergenic
1174057190 20:47806216-47806238 CCACAGCAGCGTCTAAGGGAGGG + Intergenic
1174384871 20:50181474-50181496 CAACAGTAGTAGCCCAGGGCCGG - Intergenic
1174502133 20:50992968-50992990 TCACAGCTGCAGCCCAGAGCAGG - Intergenic
1175180316 20:57142233-57142255 GCAAAGCAGCGGGCAAGGGCGGG - Intergenic
1175944691 20:62553239-62553261 CCACGGCAGTGGCGCTGGGCAGG + Intronic
1176232953 20:64041379-64041401 TCCCTGCAGAGGCCCAGGGCAGG + Intronic
1176291893 21:5050148-5050170 CCACACCTGGGGCCCTGGGCAGG - Intergenic
1176426724 21:6552946-6552968 CAGCAGCAGTGGCCCAGGGTGGG + Intergenic
1176597095 21:8757614-8757636 CCAGAGCAGCAGCCTAGGGGTGG + Intergenic
1176642911 21:9323559-9323581 CCAGAGCAGCAGCCTAGGGGTGG + Intergenic
1179397484 21:41054779-41054801 CATCAGCAGCGGGCCAGGGTCGG + Intergenic
1179616522 21:42586763-42586785 CCACAGCAGGGGCCCCCGGCAGG + Intergenic
1179641608 21:42751312-42751334 CACCGTCAGCGGCCCAGGGCTGG - Intronic
1179702215 21:43161268-43161290 CAGCAGCAGTGGCCCAGGGTGGG + Intronic
1180025677 21:45160295-45160317 CCACTGCAGCGGCTCCCGGCAGG - Intronic
1180139062 21:45880351-45880373 CCACAGAGGCGGCACAGGGCTGG - Intronic
1180319598 22:11308151-11308173 GCACACCAGCGGCTCACGGCCGG - Intergenic
1180351935 22:11812962-11812984 CCAGAGCAGCAGCCGAGGGGTGG + Intergenic
1180354784 22:11829599-11829621 CCGCAGCAGCTGCACAGGGGCGG + Intergenic
1180370024 22:11975640-11975662 CCAGAGCAGCAGCCTAGGGGTGG - Intergenic
1180386275 22:12179108-12179130 CCAGAGCAGCAGCCTAGGGGTGG - Intergenic
1180421345 22:12817218-12817240 CCAGAGCAGCAGCCTAGGGGTGG - Intergenic
1180535157 22:16389370-16389392 CTTCCCCAGCGGCCCAGGGCTGG - Intergenic
1180597718 22:16989698-16989720 ACACAGCTGCTGCCCAGGGAGGG + Intronic
1180730743 22:17980238-17980260 AAACAGCAGCAGCTCAGGGCAGG + Intronic
1180961373 22:19763847-19763869 CCACCGCAGCGGCACCGGGGCGG + Intronic
1181474865 22:23161789-23161811 CCACACCACCGGGCCAGTGCAGG + Exonic
1182098564 22:27642158-27642180 ACACAGCAGGGGTCGAGGGCAGG + Intergenic
1182686890 22:32128094-32128116 GCAGAGCAGCAGCCCAGGCCTGG - Intergenic
1182714721 22:32348375-32348397 GCAGAGCAGCAGCCCAGGCCTGG + Intergenic
1182738061 22:32545240-32545262 GCACAAAAGCAGCCCAGGGCTGG - Intronic
1183063564 22:35349406-35349428 CCACAGAAGGCCCCCAGGGCTGG + Intergenic
1183361503 22:37385531-37385553 GCACAGCAGTGGCACAGGCCGGG + Intronic
1183466839 22:37984284-37984306 TCACAGCAGGGTCCCAGGCCTGG + Intronic
1183489514 22:38109083-38109105 GAACAGCAGAGGCCCAGGGCTGG + Intronic
1184376871 22:44119180-44119202 TCCCTGCAGCGGCCCTGGGCTGG + Intronic
1184453553 22:44596871-44596893 CCACCACAGCAGCGCAGGGCAGG + Intergenic
1184713959 22:46269691-46269713 CCACAGCAGAGTCCCTTGGCAGG - Intronic
1185109054 22:48890661-48890683 CCACAGCTGCTGCCCCAGGCTGG - Intergenic
1185157213 22:49201233-49201255 GCACAGAAGGGTCCCAGGGCGGG - Intergenic
1185190374 22:49432660-49432682 CCTCAGCACTGGCCCTGGGCTGG + Intronic
1185199569 22:49493455-49493477 CCAGGGCAGCAGCCCAGGCCTGG - Intronic
1185304141 22:50103257-50103279 CCTCAGGAGCAGGCCAGGGCTGG - Intronic
1185377557 22:50489178-50489200 GCTCAGCAGCCGCCCAGGGAAGG - Intronic
949654728 3:6204940-6204962 CCTCAGAAGTGGCCTAGGGCAGG - Intergenic
949935184 3:9110705-9110727 CCACAGGAGGGAGCCAGGGCTGG - Intronic
950702057 3:14757595-14757617 CCACTGGAGCTGCCCAGTGCTGG - Exonic
950788722 3:15455815-15455837 CCACAGCTGGTGTCCAGGGCTGG + Intronic
952711125 3:36433029-36433051 CTGCAGCAGAGCCCCAGGGCAGG + Intronic
953163673 3:40445216-40445238 CCACTGCAGCTGCCCAGGCCCGG + Intergenic
954244025 3:49316745-49316767 AGCCAGCAGAGGCCCAGGGCAGG - Intronic
961470768 3:127110137-127110159 CCAGAGCAGGGGGCCAGGGAGGG + Intergenic
961667793 3:128504414-128504436 ACACAGCAGGGGCCCAGAACTGG + Intergenic
962346972 3:134625584-134625606 CCACAGCCACGGCCCTGGGGTGG + Intronic
963214004 3:142724468-142724490 CCCCAGCCACGCCCCAGGGCTGG - Exonic
966418483 3:179714398-179714420 ACACAGCAGGGGCCGAGGCCAGG - Intronic
966863180 3:184241801-184241823 CTACGGCAGTGGCCCAGGTCCGG - Exonic
967307798 3:188075952-188075974 TCACAGCAGAAGCCCAGGCCTGG + Intergenic
967857553 3:194129778-194129800 CCACAGCAGCGGCGGTGGGCAGG - Intergenic
968123607 3:196143039-196143061 CCTCCGCAGCTCCCCAGGGCGGG + Intergenic
968129116 3:196182116-196182138 TCACAGCAGAGGCTCAGGGAGGG - Intergenic
1202743974 3_GL000221v1_random:81454-81476 CCAGAGCAGCAGCCTAGGGGTGG - Intergenic
968425999 4:523697-523719 CCACAGCAGCGTGGCAGGACGGG + Exonic
968503054 4:960093-960115 CCACACCTGCTGCCCAGGGCGGG + Exonic
968601034 4:1509440-1509462 CCACGGATGTGGCCCAGGGCCGG - Intergenic
968757404 4:2423900-2423922 ACCCAGCCGGGGCCCAGGGCAGG + Intronic
968882309 4:3307640-3307662 GCACACCCACGGCCCAGGGCAGG - Intronic
969456256 4:7301363-7301385 CCTCAGCACAGGCCCAGGGAGGG + Intronic
969500177 4:7547784-7547806 CCACAGATGCACCCCAGGGCAGG + Intronic
973360396 4:49159836-49159858 CCAGAGCAGCAGCCTAGGGGTGG + Intergenic
973760308 4:54109267-54109289 CCAAATCAGCTGCCTAGGGCGGG + Intronic
974469751 4:62302996-62303018 ACACAGCAGAGTCCCAGTGCTGG + Intergenic
981090503 4:140727376-140727398 CCACAGCAGTGGGGCAGGCCAGG + Intronic
981824907 4:148928949-148928971 CCCCAGCACCAGCCCAGAGCTGG + Intergenic
984699235 4:182807863-182807885 CTTCGGCAGAGGCCCAGGGCGGG - Intergenic
984778622 4:183504993-183505015 CCGCAGCACCAGCCCAGGGGCGG - Exonic
984879261 4:184396290-184396312 CCAGGGCAGCGACACAGGGCGGG + Intronic
985247917 4:187995629-187995651 CCAGGGCGGCGCCCCAGGGCGGG + Intergenic
985551217 5:534538-534560 CCTCTGCAGGGCCCCAGGGCTGG - Intergenic
986576740 5:9220863-9220885 CCACAGCAGCGCCGCATGGTGGG + Intronic
992406081 5:76459188-76459210 CCTCAGCAGCTGTCCTGGGCTGG + Intronic
993015079 5:82526163-82526185 CTTCAGCAGTGACCCAGGGCAGG - Intergenic
997612863 5:135227389-135227411 CCTCTTCAGCTGCCCAGGGCTGG + Intronic
997690723 5:135825882-135825904 CCTCAGGGGCTGCCCAGGGCTGG + Intergenic
998415222 5:141941176-141941198 CCATAGCTGGGGCCGAGGGCTGG + Exonic
1002133091 5:177093156-177093178 CCGCAGCAGCGCCCGAGGCCAGG + Exonic
1002529285 5:179834321-179834343 ACACAGCGGCGGCCCACAGCAGG - Intronic
1007583516 6:42974092-42974114 ACACAGCAGTGGCCCTGGTCAGG + Intronic
1007720880 6:43884858-43884880 CCAGAGGAGGGGCCCTGGGCAGG - Intergenic
1008552601 6:52647220-52647242 CCACAGCACCAACCCAGGACAGG - Intergenic
1009610307 6:65931649-65931671 CCACTGCAGCTGCCCAAGCCAGG - Intergenic
1013003649 6:106049618-106049640 CCACAGAAGCAGCCCAGGAGAGG - Intergenic
1015187984 6:130440548-130440570 CCACAACATCTGCCCGGGGCCGG - Exonic
1015458446 6:133458490-133458512 CCACAGCAGTGATCCAGGGCAGG + Intronic
1018399052 6:163404296-163404318 CTACAGGTGTGGCCCAGGGCTGG + Intergenic
1018429812 6:163713795-163713817 CCACAGGAGGGTCCCAGGCCAGG + Intergenic
1018785551 6:167105215-167105237 CCACAGCAGGGGCTCAGGTTTGG + Intergenic
1019090824 6:169531602-169531624 TCACAGCAGGTGCACAGGGCAGG + Intronic
1019213801 6:170427097-170427119 CCAGACCAGCAGCCCAGGACAGG - Intergenic
1019325036 7:433796-433818 CCCAGGCAGCGGCACAGGGCTGG + Intergenic
1019425610 7:975264-975286 CCGCAGCAGTGACCCAGGGCTGG + Intronic
1019442559 7:1054846-1054868 GCACAGCGGAGGCCGAGGGCAGG - Intronic
1019557618 7:1640615-1640637 CCCCAGCAGGGGCCGAGGGGTGG - Intergenic
1020096875 7:5374365-5374387 CCGCGGCAGCAGCCCGGGGCCGG + Exonic
1020203930 7:6101203-6101225 CCACAGCAGCAGACAAGGGATGG + Intergenic
1021855596 7:24851955-24851977 CCACAGTAGGGGGGCAGGGCAGG + Intronic
1021998234 7:26201269-26201291 CCACAGACGCGGGCCAGGGGTGG - Exonic
1022092700 7:27117861-27117883 CCACTGCAGCAGGGCAGGGCTGG - Intronic
1022106231 7:27199744-27199766 CTACAGCAGCGCCCCCGGGGAGG - Exonic
1023892100 7:44400319-44400341 CCACATCAGCCAGCCAGGGCAGG - Intronic
1023962108 7:44935582-44935604 CCTCAGCACCAGCCCAGGGTGGG - Intergenic
1024881886 7:54096225-54096247 GCACAGCAGTGGCCCAGGGGAGG - Intergenic
1029206013 7:98869786-98869808 CCCCTGCCGGGGCCCAGGGCAGG + Exonic
1029813981 7:103075232-103075254 CCGCAGCGCCGGGCCAGGGCAGG - Exonic
1031406914 7:121396538-121396560 CCGCCGCAGCGGCCCTGCGCCGG + Intergenic
1032095752 7:128937897-128937919 CAGCAGCAGCTGCCCAGGGGCGG + Intronic
1034275493 7:149822067-149822089 CCGCAGCTGCGGCCCGGGCCTGG + Intergenic
1034329388 7:150269500-150269522 CGTCAGCACCGGCCCAGGGAAGG + Intronic
1034668668 7:152840361-152840383 CGTCAGCACCGGCCCAGGGAAGG - Intronic
1034929916 7:155153495-155153517 ACTCAGGAGGGGCCCAGGGCTGG - Intergenic
1035225923 7:157432162-157432184 GCACAGCAGACGCCCACGGCAGG + Intergenic
1035289673 7:157829901-157829923 CCACTGCAGAGGTGCAGGGCAGG - Intronic
1035902964 8:3477878-3477900 CCACTGCAGAGGGCCAGGGCAGG + Intronic
1036597484 8:10227049-10227071 CCACAGCTGCTCCCCAGGGATGG - Intronic
1037662342 8:20938850-20938872 CCTCAGCTGCAGACCAGGGCGGG - Intergenic
1037834350 8:22207387-22207409 CCACAGAAGCGGCCGAGGACGGG - Exonic
1037879456 8:22565850-22565872 CCGGAGCAGCGGCCCCCGGCCGG + Exonic
1037976633 8:23218649-23218671 CCCCAGCAGTGACCCAGCGCTGG + Intronic
1038304106 8:26383511-26383533 CCCCAGCAGCGGAGCCGGGCGGG + Intronic
1038525298 8:28267863-28267885 AGACAGCCGTGGCCCAGGGCTGG + Intergenic
1039273339 8:35907137-35907159 CCTTAGCAGCTTCCCAGGGCTGG - Intergenic
1039549008 8:38429925-38429947 CCACAGGGGCTCCCCAGGGCTGG + Exonic
1039842512 8:41304080-41304102 CCGCAGCAGGAGGCCAGGGCAGG + Intronic
1039914293 8:41848524-41848546 CCAGGCCAGGGGCCCAGGGCTGG - Intronic
1040625959 8:49150404-49150426 CCACAGCAAGTGCCAAGGGCTGG + Intergenic
1041009829 8:53530841-53530863 GCCCAGCAGAGGCCCAGCGCAGG + Intergenic
1044377144 8:91488930-91488952 ACACAGCAATGCCCCAGGGCAGG + Intergenic
1047318693 8:123758176-123758198 CCACCTCAGCTGCCCAGGGCTGG + Intergenic
1048563594 8:135569741-135569763 GCACAGCAGTCACCCAGGGCAGG + Intronic
1048944475 8:139431654-139431676 CCACAGGAGCCTCCCGGGGCAGG + Intergenic
1049252294 8:141595791-141595813 GCCCAGCACCGGCCCAGAGCAGG + Intergenic
1049258862 8:141628123-141628145 GCACAGCTGAGGCTCAGGGCTGG + Intergenic
1049349239 8:142155135-142155157 GCACAGCAGCAGCCCCTGGCAGG + Intergenic
1049407805 8:142459419-142459441 CCACAGCAGCTGCCCCAGGGTGG + Intronic
1049461323 8:142729662-142729684 CCACAGAAGCGACTGAGGGCAGG + Intronic
1049599706 8:143501717-143501739 TCACACCAGCGCCCCGGGGCCGG - Intronic
1050064286 9:1742597-1742619 GCACAGCAGAGGCCTATGGCAGG - Intergenic
1051894611 9:21974756-21974778 CCACGGCCGCGGCCCGGGGTCGG - Exonic
1052337909 9:27338395-27338417 TCCCAGCAGCGCCCCAGAGCTGG + Intronic
1053014115 9:34652143-34652165 CCGCTGCGGGGGCCCAGGGCGGG + Intronic
1055530280 9:77177263-77177285 CCCCAGCGGCCCCCCAGGGCGGG - Intergenic
1057562680 9:96140506-96140528 CCACACCAGCCGGCGAGGGCGGG - Intergenic
1057800294 9:98186895-98186917 CCACAGCAGCACTCCAGGCCTGG + Intronic
1058979746 9:110158060-110158082 CTGCAGCAGCTACCCAGGGCCGG - Intronic
1059392808 9:114009510-114009532 CCACGGCACCTGCCCTGGGCTGG - Intronic
1059449709 9:114362693-114362715 CCACGGCAGCTCTCCAGGGCAGG - Intronic
1060347264 9:122828143-122828165 ACACAGCAGCGGCGGAGGGGAGG + Intronic
1060517042 9:124272357-124272379 CCACAGCACCAGCCCTGTGCAGG - Intronic
1060596975 9:124854284-124854306 CCACAGCAGCTGCCCACTCCGGG - Exonic
1060996328 9:127876576-127876598 CCTCAGCAGCTGCCCATGGGAGG + Intronic
1061138657 9:128751294-128751316 ACCCAGCAGAGGCCAAGGGCTGG + Intronic
1061221199 9:129253279-129253301 CCACAGCTGAGGCACAGGCCTGG - Intergenic
1061627834 9:131851955-131851977 CCGCAGCAGCTGCCCATGACAGG + Intergenic
1061781616 9:132999635-132999657 CCACTGCAGTGGCTCAAGGCTGG - Intergenic
1061890528 9:133616891-133616913 CCACAGCAGGGGCCCGAGGGTGG - Intergenic
1061944061 9:133898722-133898744 CCACAGCACCAGCTCAGGCCTGG - Intronic
1062005646 9:134237269-134237291 ACACAGCAGCTGCCCAGCGCTGG + Intergenic
1062037057 9:134387052-134387074 CCACAGCAGCGGCCCAGGGCAGG - Intronic
1062140615 9:134955983-134956005 CCACAGCAAAGGCCAAGGGGAGG - Intergenic
1062359969 9:136183027-136183049 CCCCAGCAGGTGCCCTGGGCTGG + Intergenic
1062424310 9:136498964-136498986 TCACGGCGGCGGCCCAGTGCAGG + Exonic
1062463455 9:136671350-136671372 CAACAGCAGAGGCCCAGGCCCGG + Intronic
1062550611 9:137084602-137084624 TCACAGCTGTGTCCCAGGGCTGG + Intergenic
1203689431 Un_GL000214v1:28929-28951 CCAGAGCAGCAGCCTAGGGGTGG + Intergenic
1203712606 Un_KI270742v1:111420-111442 CCAGAGCAGCAGCCTAGGGGTGG - Intergenic
1203556200 Un_KI270743v1:209739-209761 CCAGAGCAGCAGCCTAGGGGTGG - Intergenic
1203646844 Un_KI270751v1:75124-75146 CCAGAGCAGCAGCCTAGGGGTGG - Intergenic
1185464854 X:348094-348116 CTACAGCAGCGACCCATGGCAGG + Intronic
1185731344 X:2464338-2464360 GCACATCAGCGGCCCTTGGCCGG - Intronic
1189339450 X:40193491-40193513 CCACACCAGAGCCCCATGGCTGG + Intergenic
1189446777 X:41086665-41086687 CCACTCCAGGAGCCCAGGGCCGG - Intronic
1192978984 X:76318750-76318772 CCACAGTACCAGCCCAGAGCTGG - Intergenic
1195649913 X:107273488-107273510 CTAGAGCAGCTGGCCAGGGCGGG - Intergenic
1195749512 X:108150091-108150113 CAACAGCAGTGGGCCAGGACCGG + Intronic
1196049556 X:111290478-111290500 CCGGAGCAGAGGCCCAGGTCTGG + Intergenic
1199367778 X:147007221-147007243 CCACTGCAGCCGGCCATGGCTGG - Intergenic
1199872690 X:151913048-151913070 CTCCAGGAGTGGCCCAGGGCTGG - Intronic
1199874436 X:151919800-151919822 CCCCACGAGTGGCCCAGGGCTGG - Intronic
1199987887 X:152965361-152965383 CCACAGGAGTGGTTCAGGGCTGG - Intronic
1200133288 X:153862892-153862914 TCACTGCAGAGGCACAGGGCAGG + Exonic
1200685511 Y:6254940-6254962 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1200687902 Y:6273549-6273571 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1200991041 Y:9346181-9346203 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1200993699 Y:9366474-9366496 CCAGGGAAGCAGCCCAGGGCTGG - Intronic
1200996362 Y:9386792-9386814 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1200998877 Y:9455347-9455369 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1201001531 Y:9475656-9475678 CCAGGGAAGCAGCCCAGGGCTGG - Intronic
1201004197 Y:9495958-9495980 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1201006852 Y:9516270-9516292 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1201009504 Y:9536576-9536598 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1201012095 Y:9557278-9557300 CCAGGGAAGCAGCCCAGGGCTGG - Intergenic
1201047367 Y:9901153-9901175 CCAGGGAAGCAGCCCAGGGCTGG + Intergenic
1201070861 Y:10146340-10146362 GCACACCAGCGGCTCACGGCCGG + Intergenic
1202131984 Y:21621061-21621083 CCAGGGAAGCAGCCCAGGGCTGG + Intergenic