ID: 1062037849

View in Genome Browser
Species Human (GRCh38)
Location 9:134390654-134390676
Sequence GTTGAGCTCCGCCGCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062037848_1062037849 -7 Left 1062037848 9:134390638-134390660 CCTCTGGGCTGGTGTCGTTGAGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1062037849 9:134390654-134390676 GTTGAGCTCCGCCGCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062037849 Original CRISPR GTTGAGCTCCGCCGCAGCCC TGG Intronic
No off target data available for this crispr