ID: 1062038445

View in Genome Browser
Species Human (GRCh38)
Location 9:134393057-134393079
Sequence CCCGGGAATCATGGGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062038433_1062038445 -4 Left 1062038433 9:134393038-134393060 CCCATCCTGCCCTGGGAAACCCG 0: 1
1: 0
2: 1
3: 18
4: 140
Right 1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG No data
1062038437_1062038445 -9 Left 1062038437 9:134393043-134393065 CCTGCCCTGGGAAACCCGGGAAT 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG No data
1062038434_1062038445 -5 Left 1062038434 9:134393039-134393061 CCATCCTGCCCTGGGAAACCCGG 0: 1
1: 0
2: 1
3: 21
4: 252
Right 1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062038445 Original CRISPR CCCGGGAATCATGGGGAAGC GGG Intronic
No off target data available for this crispr