ID: 1062038469

View in Genome Browser
Species Human (GRCh38)
Location 9:134393183-134393205
Sequence CCCAGGTCGCTCATGGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062038469_1062038473 0 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038473 9:134393206-134393228 CGCTCTTCTCCCTGTAGCACTGG No data
1062038469_1062038479 13 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038479 9:134393219-134393241 GTAGCACTGGGGCACACACAGGG No data
1062038469_1062038481 22 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038481 9:134393228-134393250 GGGCACACACAGGGTGGTGAAGG No data
1062038469_1062038482 23 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038482 9:134393229-134393251 GGCACACACAGGGTGGTGAAGGG No data
1062038469_1062038478 12 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038478 9:134393218-134393240 TGTAGCACTGGGGCACACACAGG No data
1062038469_1062038484 25 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038484 9:134393231-134393253 CACACACAGGGTGGTGAAGGGGG No data
1062038469_1062038483 24 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038483 9:134393230-134393252 GCACACACAGGGTGGTGAAGGGG No data
1062038469_1062038475 2 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038475 9:134393208-134393230 CTCTTCTCCCTGTAGCACTGGGG No data
1062038469_1062038480 16 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038480 9:134393222-134393244 GCACTGGGGCACACACAGGGTGG No data
1062038469_1062038474 1 Left 1062038469 9:134393183-134393205 CCTAAAGCCATGAGCGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1062038474 9:134393207-134393229 GCTCTTCTCCCTGTAGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062038469 Original CRISPR CCCAGGTCGCTCATGGCTTT AGG (reversed) Intronic
900079816 1:847517-847539 CCCAGGTTGCTCATGTCCTAGGG - Intergenic
900298378 1:1964335-1964357 CCCAAGTGGCACAGGGCTTTCGG + Intronic
901451703 1:9339992-9340014 CCCAGGTGGTTCAGGGCTGTCGG - Intronic
901711989 1:11122948-11122970 CCCAAGAAACTCATGGCTTTGGG + Intronic
906666038 1:47622770-47622792 CCCAGGACGCTCTAGGCTCTGGG - Intergenic
906687980 1:47774786-47774808 CACAGGGAGCTCATGCCTTTTGG + Intronic
913347768 1:117825415-117825437 GCCAGGTAGCTCAAGGGTTTGGG + Intergenic
915427764 1:155841653-155841675 CCCAGGTCCCTCATGTCCCTTGG - Intronic
916808261 1:168281088-168281110 CCCAGCTCACTCATGGCCATAGG - Exonic
917536754 1:175879736-175879758 CCCAGGTGGCTCATTCCTTAGGG + Intergenic
919766358 1:201129839-201129861 CCCAGGTGGCTTCCGGCTTTCGG + Intergenic
922740865 1:228013607-228013629 CCCAGGTCCCTCCTGGGTGTCGG - Intronic
1065755792 10:28929424-28929446 CCCAGGACCCTCATTTCTTTAGG - Intergenic
1066201143 10:33143648-33143670 CCCAGATCCCTCAGGGCTGTGGG + Intergenic
1071601098 10:86959118-86959140 CACAGGCTGCTCATGGCTTCAGG - Intronic
1075611857 10:123861053-123861075 CCCAGGGAGCTCATGGGATTGGG - Intronic
1081780748 11:45710197-45710219 CCCTGGTCCCTGATGGCTTGTGG - Intergenic
1086989611 11:93288579-93288601 CCCAGATCGTTCATGATTTTAGG + Intergenic
1089438945 11:118498384-118498406 CCACGGTGGCTCCTGGCTTTTGG - Exonic
1090326218 11:125888119-125888141 CCCAGGTCGCTAGCGGCCTTCGG - Intronic
1091853024 12:3715803-3715825 CCCAGGACCCTCATTTCTTTAGG - Intronic
1108899368 13:55380339-55380361 CACAGGTCTCTCATTTCTTTGGG + Intergenic
1112520417 13:100089491-100089513 CCGAGGCGGCTGATGGCTTTGGG + Intronic
1112995633 13:105571678-105571700 GCCAGGTAGCTCATGCATTTGGG + Intergenic
1116444299 14:44990857-44990879 CCCAGGTCGGTCTTGGACTTGGG + Intronic
1116811464 14:49543666-49543688 CCCAGTTCTCTCATGGCTGTTGG - Intergenic
1118689337 14:68323139-68323161 CCCTGGGCGCTCCTGTCTTTGGG - Intronic
1128671703 15:69578554-69578576 CTCAGGTGGCTCATGGCTCGGGG + Intergenic
1128740931 15:70083239-70083261 CTCAAGTCCCTCCTGGCTTTAGG + Intronic
1129874115 15:78961495-78961517 CCCACGTCGCTCCTTGCTCTAGG - Exonic
1130546946 15:84863607-84863629 CCCGGGCCGCGCCTGGCTTTGGG + Exonic
1130954790 15:88620030-88620052 CCCAGGCCCCTGAAGGCTTTGGG - Intergenic
1131255299 15:90858179-90858201 CCCAGCTCCCTCATCTCTTTTGG - Intergenic
1132471269 16:104769-104791 CCCAGGTCTGCCATGGCCTTTGG - Intronic
1132850900 16:2024491-2024513 CTCAGCTCCTTCATGGCTTTGGG + Intergenic
1133645134 16:7756928-7756950 CCTGGGTGGCTCATGACTTTGGG - Intergenic
1134250316 16:12569447-12569469 CCCAAGTCTCTCATGACTGTAGG - Exonic
1136343660 16:29661891-29661913 CCCAGGAGTCTCATGTCTTTGGG + Intergenic
1140097648 16:71888983-71889005 GCGAGGTGGCTCATGCCTTTGGG + Intronic
1143136229 17:4714199-4714221 CCCTGGTCGCTCCTTGTTTTGGG - Intronic
1151437286 17:74105683-74105705 CCCAGGTCGCTTTTGGTCTTGGG + Intergenic
1152822628 17:82445062-82445084 CCCAGGTCACCTGTGGCTTTGGG - Intronic
1153007312 18:508770-508792 CACAGGCCTCTCATGGCTCTAGG + Intergenic
1161555447 19:4939659-4939681 CACAGGTGGCTCTTGGCTATGGG - Intronic
1161616573 19:5274237-5274259 TCCAGGTCACTCGTGGCTTGGGG + Exonic
1166122134 19:40692296-40692318 CCCAGGGCCCTTATGACTTTGGG - Exonic
928231692 2:29504293-29504315 GCCAGGTCACACAGGGCTTTAGG + Intronic
933275014 2:80274422-80274444 CCCAGTTCGCTCTGGGCTGTGGG + Intronic
941349728 2:164417249-164417271 CCCAGGAGTGTCATGGCTTTTGG - Intergenic
944579333 2:201118329-201118351 CCCGGGTCGCGCAAGACTTTCGG - Intronic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
1169075712 20:2758862-2758884 CCCAGGTGGCACATGGCTTATGG + Intronic
1173201339 20:40957439-40957461 ACCAGGTCCCTCATGGCCCTGGG - Intergenic
1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG + Intronic
1185080799 22:48708401-48708423 CCCAGGTCAGCCGTGGCTTTGGG - Intronic
953324160 3:41998566-41998588 CCCAGCTGGGTCATGGCTGTTGG - Intergenic
956341236 3:68226472-68226494 CCCATGTCTGTCATGCCTTTTGG + Intronic
960166770 3:114411300-114411322 CCCAGGTCCCCCATGGCTCCAGG + Intronic
964954806 3:162340216-162340238 CCCAGGATGCTCATCTCTTTAGG - Intergenic
967874738 3:194260109-194260131 GGCAGATCCCTCATGGCTTTTGG + Intergenic
968267147 3:197370978-197371000 CCCAGCTCTCTCGTGGCTTAGGG - Intergenic
969452873 4:7284886-7284908 CCCAGGTATCTCTTGGCTTGTGG + Intronic
973719459 4:53708403-53708425 CCAAGGTCCGTCATGACTTTGGG - Intronic
988316767 5:29641320-29641342 CCCAGGACTCTCAGGTCTTTCGG - Intergenic
989155212 5:38338416-38338438 CCCAGGAGGCTCATGCATTTTGG + Intronic
991454671 5:66789748-66789770 CCCAGGTTGCTCATAGATTGTGG - Intronic
992037383 5:72793685-72793707 CCTAGATCCCTCATGGTTTTGGG - Intergenic
993103978 5:83577537-83577559 CCCAGGTAGATCCTGGCATTTGG + Intronic
995585353 5:113642774-113642796 CCCAGGCTGCCCAAGGCTTTGGG + Intergenic
1002429652 5:179195638-179195660 CCCAGGTGGCTGAAGGCTGTTGG - Intronic
1004288404 6:14344543-14344565 CCAAGGTGGTTCATTGCTTTGGG + Intergenic
1006846851 6:37068273-37068295 CCCAGGACGCTCAGTTCTTTAGG + Intergenic
1009736236 6:67679688-67679710 CCCAAGTAGCTAATGGCTTTTGG - Intergenic
1014053517 6:116985805-116985827 CCTTTGTCACTCATGGCTTTTGG - Intergenic
1016785504 6:148006582-148006604 CCCAGGCTCCTCATGGTTTTGGG + Intergenic
1016814021 6:148287087-148287109 CCCAGGTCTCTGATGGCATCAGG + Intronic
1019262151 7:87712-87734 CCCAGGCAGCACATGGCTCTGGG - Intergenic
1023959113 7:44912178-44912200 CCCTGATCTCTCATGGCTTCTGG + Intergenic
1029852765 7:103481941-103481963 ACCAGGTTGCTCTTGGATTTGGG + Intronic
1030193235 7:106830342-106830364 CCGATGTCGGTCATGGATTTGGG + Intergenic
1030379789 7:108799310-108799332 CCCAGGTCTCTCATGGCATCAGG + Intergenic
1031603959 7:123747900-123747922 CTCTGGTAGCTCTTGGCTTTTGG - Intronic
1034913924 7:155021383-155021405 GCCGGGTGGCTCATGCCTTTTGG + Intergenic
1035525688 8:311399-311421 CCCAGGTTGCTCATGTCCTAGGG + Intergenic
1037951207 8:23019632-23019654 CCCAGGTTGCTCAGCGCTTCAGG - Intronic
1040691148 8:49940171-49940193 CCCAGGTCTTTCAGGGCATTTGG - Intronic
1043171387 8:76971692-76971714 CCAAGTTAGCTCTTGGCTTTGGG - Intergenic
1044179800 8:89177624-89177646 CCCAGGCCTCACATTGCTTTTGG - Intergenic
1044701351 8:94968044-94968066 CCCAGGTCGCTGCTGGCTACTGG + Intronic
1045333225 8:101175215-101175237 CCCAGGTCCCTCAGTTCTTTAGG + Intergenic
1045503995 8:102765763-102765785 CCAAGGTCACACATAGCTTTAGG + Intergenic
1047783057 8:128125542-128125564 CCCAGGACGTGCCTGGCTTTGGG - Intergenic
1053250890 9:36573084-36573106 CCCAGTTTGCTCCTGGCTCTCGG + Intronic
1057755654 9:97832922-97832944 TTCAGGTTGCTCATGGCTCTGGG - Intergenic
1061664382 9:132151912-132151934 CCCAGGTAGCTGCTGGGTTTGGG + Intergenic
1062038469 9:134393183-134393205 CCCAGGTCGCTCATGGCTTTAGG - Intronic
1186660609 X:11664868-11664890 CCCTGGACGCTGGTGGCTTTGGG + Exonic
1188649946 X:32620041-32620063 CCCAGGTTCCTCTTGGCCTTTGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic