ID: 1062038736

View in Genome Browser
Species Human (GRCh38)
Location 9:134394602-134394624
Sequence TCCGCAGGGGATCCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062038736_1062038745 22 Left 1062038736 9:134394602-134394624 CCTGCCTTTGGATCCCCTGCGGA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1062038745 9:134394647-134394669 CTTGCACGCTACGTGCCTCAGGG No data
1062038736_1062038746 23 Left 1062038736 9:134394602-134394624 CCTGCCTTTGGATCCCCTGCGGA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1062038746 9:134394648-134394670 TTGCACGCTACGTGCCTCAGGGG No data
1062038736_1062038739 -10 Left 1062038736 9:134394602-134394624 CCTGCCTTTGGATCCCCTGCGGA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1062038739 9:134394615-134394637 CCCCTGCGGACTGAGCTGCCTGG No data
1062038736_1062038744 21 Left 1062038736 9:134394602-134394624 CCTGCCTTTGGATCCCCTGCGGA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1062038744 9:134394646-134394668 ACTTGCACGCTACGTGCCTCAGG No data
1062038736_1062038747 30 Left 1062038736 9:134394602-134394624 CCTGCCTTTGGATCCCCTGCGGA 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1062038747 9:134394655-134394677 CTACGTGCCTCAGGGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062038736 Original CRISPR TCCGCAGGGGATCCAAAGGC AGG (reversed) Intronic
900269389 1:1779140-1779162 TACGCTTGGGATCCCAAGGCTGG + Intronic
901852010 1:12021848-12021870 TCCTCTGGGGTTCCCAAGGCGGG - Intronic
906120976 1:43390135-43390157 TCCGCAGGGGTACCATAGTCGGG - Intronic
907676858 1:56525897-56525919 TCCTCAAGGGCTCCAAAGTCTGG + Intronic
911084196 1:93963044-93963066 TCAGAAGGGGATGCAAAGACAGG - Intergenic
911499380 1:98666461-98666483 CAAGCAGGAGATCCAAAGGCAGG - Intronic
920382938 1:205546245-205546267 TCTGCTGGGGAGCCAAGGGCTGG + Intergenic
921213779 1:212920753-212920775 TCCTCAGGGGGTACCAAGGCAGG - Intergenic
924919266 1:248609796-248609818 TCTGCAGGGGATTCCAGGGCAGG + Intergenic
1064683714 10:17837171-17837193 GCCCCAGGAGATCCAGAGGCTGG + Intronic
1067916707 10:50407578-50407600 TCCACAGGTGATGCAATGGCAGG - Intronic
1070517330 10:77220405-77220427 TCTGCAGTGGCTCCAACGGCTGG + Intronic
1070723303 10:78771592-78771614 CCCCCAGGAAATCCAAAGGCAGG + Intergenic
1073731779 10:106296598-106296620 TCCTCAGGGGAAGCAAAGACAGG + Intergenic
1075289198 10:121213902-121213924 TCCGCTGGGGATCCCCTGGCTGG + Intergenic
1075688101 10:124377899-124377921 TCCTCCCGGGATCCCAAGGCAGG - Intergenic
1078084211 11:8224178-8224200 TGGGCAGGGGAGCAAAAGGCTGG - Intergenic
1080457268 11:32428719-32428741 TCCGCTGGGGGTCCGAATGCGGG - Intronic
1085529414 11:77182665-77182687 TCTGCAGAGGAGCCCAAGGCTGG - Intronic
1089633677 11:119798797-119798819 CCAGCAGGGGATCCAAAGGTTGG + Intergenic
1090406047 11:126476282-126476304 TCCCCAGGGGGTCCCATGGCAGG + Intronic
1091546040 12:1501911-1501933 TCTGCAGGGGACCCAAAAGCAGG - Intergenic
1097043805 12:56172490-56172512 TCTGCAGGGGAAACACAGGCAGG + Exonic
1099305926 12:80955895-80955917 TCAGTAGGGCATCCAAAGGTAGG - Intronic
1101217988 12:102604286-102604308 TACACATGGGCTCCAAAGGCAGG + Intergenic
1105474380 13:20718114-20718136 GCCGCAGGAAAACCAAAGGCGGG - Intronic
1109932563 13:69235011-69235033 AGGGCAGGGGATCCCAAGGCTGG + Intergenic
1111051741 13:82891651-82891673 GCTCCAGAGGATCCAAAGGCAGG + Intergenic
1113249701 13:108438293-108438315 TCTGCCGTGTATCCAAAGGCAGG - Intergenic
1114876015 14:26719021-26719043 GCCTCATGGAATCCAAAGGCAGG + Intergenic
1121021552 14:90583278-90583300 TCAGCAGAGGATCTACAGGCTGG + Intronic
1122309437 14:100785247-100785269 TCTGCAGGGGAGCAGAAGGCAGG - Intergenic
1123625877 15:22226563-22226585 ACCGCAGGGGCTCCTGAGGCTGG + Intergenic
1128332158 15:66762993-66763015 TCAGAAGGGGATCCCAAGACTGG - Intronic
1128769906 15:70274273-70274295 GCCCCACGGGTTCCAAAGGCTGG - Intergenic
1130286314 15:82557906-82557928 ACCCAAGGGGATCCAGAGGCAGG + Exonic
1131514969 15:93071387-93071409 TCCGCAGGGGATCAAACAGCAGG - Intronic
1133475701 16:6119696-6119718 TCCACAGGGTATCCACAGGCTGG + Intronic
1134237485 16:12478725-12478747 TCCCCAGGGGATCCAAAGCACGG - Intronic
1135123145 16:19784102-19784124 TCCGCAGGGAATCCTATGTCAGG - Intronic
1135163978 16:20122335-20122357 GCCTCAGGGTATCCAACGGCTGG - Intergenic
1136612833 16:31377686-31377708 TTGGCAGGGGACCCACAGGCAGG + Intronic
1142139423 16:88466142-88466164 TCCTCTGGGAACCCAAAGGCAGG + Intronic
1144736691 17:17559558-17559580 TCCTCAGAGGTGCCAAAGGCTGG + Intronic
1152564949 17:81096215-81096237 TCAGCAGGAGATCCAACGCCTGG - Intronic
1158440581 18:57471134-57471156 TCCAGAGGGGATGCAAAGGGAGG - Intronic
1158474288 18:57766274-57766296 ACCTCAGGTGATCCACAGGCAGG + Intronic
1166170292 19:41023590-41023612 ACCTCAGGTGATCCAAGGGCTGG - Intergenic
1167108395 19:47444710-47444732 CCCTCAGGGGACCCAAATGCAGG + Intronic
926689020 2:15720023-15720045 TCCGCAGGGTCTGTAAAGGCTGG - Intronic
928292726 2:30053793-30053815 TCCACTGGGGATCCAAAGACAGG + Intergenic
929143847 2:38689237-38689259 TTTGCAGGGGAGTCAAAGGCTGG - Intronic
931515029 2:63045308-63045330 CCCGCTGGGGATCCAAATACTGG + Intronic
947533819 2:230928654-230928676 CCAGCAGGGGAGACAAAGGCAGG - Intronic
947843712 2:233226890-233226912 TCAGCAGGGGACAAAAAGGCAGG - Intronic
948320576 2:237065578-237065600 TCAGGAGGGCATCCACAGGCAGG - Intergenic
1172410197 20:34715784-34715806 TCCAAAAGGGATCCCAAGGCAGG - Intronic
1176187055 20:63786349-63786371 CCAACGGGGGATCCAAAGGCAGG + Intronic
1179610518 21:42547376-42547398 TGCTAAGGGGAACCAAAGGCTGG + Intronic
1179643410 21:42761306-42761328 TCCGCAGGGAAAGCACAGGCAGG + Intronic
1181500606 22:23313641-23313663 TCCCCAGAGGAGCCCAAGGCAGG - Intronic
1181976241 22:26732340-26732362 TCTGCAGGGGATCCCTAGGAGGG - Intergenic
1185211203 22:49571543-49571565 TCCACTGGGGACCCCAAGGCAGG + Intronic
952364924 3:32665817-32665839 TCAGCAGGTATTCCAAAGGCAGG + Intergenic
954129328 3:48552077-48552099 TCCGCAGGGGATCAGGAGTCAGG + Intronic
956726986 3:72164192-72164214 TCCCCAGGGGATTCAGATGCAGG - Intergenic
958733360 3:97981983-97982005 TCAGCAGGGGATTGAAAGGAAGG + Intergenic
961684201 3:128618117-128618139 CCCGCAGGGGCTCCCAAGGCCGG + Intergenic
965520311 3:169663355-169663377 ACAGCATGAGATCCAAAGGCAGG - Intronic
967323638 3:188217855-188217877 TCAGCTGGGAAGCCAAAGGCAGG - Intronic
968631058 4:1651766-1651788 TCAGCAAGGGACCCAAAGCCGGG + Intronic
968631069 4:1651806-1651828 TCAGCAAGGGACCCAAAGCCGGG + Intronic
968671700 4:1855735-1855757 CCCGCAGGGGCTCCGGAGGCCGG + Intronic
970001668 4:11371267-11371289 GCTGCAGGTGATCCTAAGGCGGG + Intergenic
979484052 4:121250534-121250556 TCAGCGGGAGATCTAAAGGCTGG - Intergenic
997688766 5:135811088-135811110 TCCCAGGGGGATCCAGAGGCAGG - Intergenic
1001779910 5:174359212-174359234 GCCGGAGGGGGTTCAAAGGCTGG + Intergenic
1010986861 6:82434761-82434783 ACCCAAGGGGACCCAAAGGCAGG + Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1016747700 6:147598670-147598692 TCTGCAGGGGATTCAAGGGCTGG - Intronic
1017723506 6:157260974-157260996 TTCTCCTGGGATCCAAAGGCTGG - Intergenic
1018297821 6:162368059-162368081 TGCTCAGTGGATCCAAAGGCAGG - Intronic
1019104025 6:169654550-169654572 TCAGGAGGGTCTCCAAAGGCTGG + Intronic
1026045570 7:66903687-66903709 GCCACCGGGGAGCCAAAGGCAGG - Intergenic
1031486151 7:122328464-122328486 TCCACAGGGGATGAAAAGGAAGG + Intronic
1037316157 8:17601336-17601358 CCTGCAGGGGATCTAAAGTCAGG + Intronic
1039956087 8:42208077-42208099 ACCGCAGGTGAGCCCAAGGCTGG - Intergenic
1040590718 8:48789861-48789883 TCATCAGGGGATCTAAAAGCTGG + Intergenic
1046418604 8:113948607-113948629 TCCTCAGGGGCTCCCAAGGAAGG + Intergenic
1047294819 8:123561470-123561492 TCTGCAGGGGAACCTGAGGCAGG + Intergenic
1052814636 9:33091896-33091918 TCCACAGGGGCTCCAAATGTTGG + Intergenic
1053165748 9:35842487-35842509 TCCGCAGGGGTTCCAAGGGATGG - Exonic
1053513593 9:38710364-38710386 TCCCCAGGGGCTCAAAAAGCAGG + Intergenic
1055722208 9:79187919-79187941 TCCCCAGGGGTTCCAAAGAAGGG - Intergenic
1058527840 9:105878098-105878120 TCAGCAGGGGATCCCTAGGATGG - Intergenic
1059497251 9:114720080-114720102 TCCCTAGGGGAGCCCAAGGCAGG + Intergenic
1060209225 9:121699836-121699858 TACCCAGGGGCTCCCAAGGCAGG - Intronic
1062038736 9:134394602-134394624 TCCGCAGGGGATCCAAAGGCAGG - Intronic
1203790485 EBV:148929-148951 TCCGCAGGGGCGCCGAAAGCAGG - Intergenic
1185458105 X:320355-320377 ACCGCAGGGGCTCCCGAGGCTGG - Intergenic
1186399178 X:9241071-9241093 TCCGCAGGTGATTCTGAGGCAGG - Intergenic
1186648061 X:11528513-11528535 TCCACAGGGTTTCCAAATGCAGG + Intronic
1189251305 X:39602353-39602375 TCAGCAGGGGTTCAGAAGGCTGG - Intergenic
1192159154 X:68769841-68769863 TCCCCATGGGAACTAAAGGCTGG + Intergenic
1195697712 X:107679053-107679075 TCCCCATGGGATGCAAAGGTAGG - Intergenic
1198086270 X:133285707-133285729 TCAGAATGGGTTCCAAAGGCAGG - Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic