ID: 1062039320

View in Genome Browser
Species Human (GRCh38)
Location 9:134396836-134396858
Sequence GGTCTGAGCAGGCCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 421}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062039320_1062039332 16 Left 1062039320 9:134396836-134396858 CCAGCCTGTGGCCTGCTCAGACC 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1062039332 9:134396875-134396897 TGCAGATTCCAAAGGGATGTGGG No data
1062039320_1062039323 -10 Left 1062039320 9:134396836-134396858 CCAGCCTGTGGCCTGCTCAGACC 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1062039323 9:134396849-134396871 TGCTCAGACCCTGCCGCGATTGG No data
1062039320_1062039331 15 Left 1062039320 9:134396836-134396858 CCAGCCTGTGGCCTGCTCAGACC 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1062039331 9:134396874-134396896 CTGCAGATTCCAAAGGGATGTGG No data
1062039320_1062039328 9 Left 1062039320 9:134396836-134396858 CCAGCCTGTGGCCTGCTCAGACC 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1062039328 9:134396868-134396890 TTGGCCCTGCAGATTCCAAAGGG No data
1062039320_1062039327 8 Left 1062039320 9:134396836-134396858 CCAGCCTGTGGCCTGCTCAGACC 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1062039327 9:134396867-134396889 ATTGGCCCTGCAGATTCCAAAGG No data
1062039320_1062039333 17 Left 1062039320 9:134396836-134396858 CCAGCCTGTGGCCTGCTCAGACC 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1062039333 9:134396876-134396898 GCAGATTCCAAAGGGATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062039320 Original CRISPR GGTCTGAGCAGGCCACAGGC TGG (reversed) Intronic
900014344 1:138041-138063 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
900044209 1:493243-493265 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
900065617 1:728149-728171 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
900589498 1:3453463-3453485 CATCTGGGCAGGGCACAGGCTGG - Intergenic
901020322 1:6252041-6252063 GGGCTGAGGAGGCCACTGGCCGG - Intronic
901290589 1:8121160-8121182 GGCCTGAGGAGCCCACGGGCTGG - Intergenic
901772766 1:11539009-11539031 GGCCTGTTCAGGGCACAGGCTGG + Intergenic
901872282 1:12145116-12145138 AGTCAGAGGAGGCCTCAGGCTGG - Intergenic
902490442 1:16777112-16777134 GGTGGGAGCAGGCAACAGACTGG + Intronic
903648495 1:24909131-24909153 GGCCTCAGCAGGCCGCAGGAGGG - Intronic
904343984 1:29856271-29856293 GCTCAGAGCTGGGCACAGGCTGG - Intergenic
905015713 1:34777146-34777168 GCTCTGCCCAGGCCTCAGGCAGG - Intronic
905601613 1:39256818-39256840 GGTGAGAGCAGGCCAAAGACTGG + Intronic
905788150 1:40774347-40774369 GGTCTGCGGAGGCCACAAGGGGG + Intergenic
905913131 1:41667442-41667464 GGGCTCAGCAGGCCCCAGGTGGG + Intronic
907222686 1:52918877-52918899 GTTCCTAGCAGGCCACAGACTGG - Intronic
908343399 1:63205874-63205896 GTTCTTAACAGGCCACAGACTGG - Intergenic
910058481 1:83060406-83060428 GGCCTGAGCTGGCCACTGGTTGG + Intergenic
912431401 1:109630213-109630235 GGCCTGGGCAGGCAACAGGGAGG - Exonic
912498436 1:110106311-110106333 GGTCACAGCAGGCTACAGCCCGG + Intergenic
913937365 1:125066656-125066678 CGTCTGGGCAGGCCTGAGGCTGG - Intergenic
913957303 1:143318150-143318172 AGCCAGAGCAGGCCAAAGGCAGG + Intergenic
913957933 1:143320721-143320743 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
914051617 1:144143514-144143536 AGCCAGAGCAGGCCAAAGGCAGG + Intergenic
914052242 1:144146079-144146101 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
914126955 1:144820462-144820484 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
914127580 1:144823027-144823049 AGCCAGAGCAGGCCAAAGGCAGG - Intergenic
914218442 1:145655842-145655864 GGTCTGGGCAGTCCAGAGGAGGG - Intronic
914471001 1:147978533-147978555 GGTCTGGGCAGTCCAGAGGAGGG - Intronic
914985074 1:152449540-152449562 GATCTGAGCAGGACACAGGAAGG + Intergenic
915598548 1:156908605-156908627 GGTCTGAGCTGGGCAGGGGCAGG - Intronic
916488167 1:165277660-165277682 TGTCAGTGCTGGCCACAGGCAGG + Intronic
916587840 1:166164326-166164348 AGTCAGAGAAAGCCACAGGCAGG - Intronic
917046058 1:170861436-170861458 GGTCCCAGCAGGCCAAAGGTTGG + Intergenic
918716027 1:187787950-187787972 AGTTTGAGCAGGGCACAGGCTGG + Intergenic
918811144 1:189122698-189122720 GTTCCCAGCAGGCCACAGGCTGG - Intergenic
919769039 1:201145405-201145427 GGTCTGCACAGGGCACTGGCTGG + Intronic
920316366 1:205078202-205078224 GGTCCAAGCAGAGCACAGGCAGG + Exonic
920336529 1:205248923-205248945 GGGGTGAGCAGGACACAGTCAGG - Intronic
922100189 1:222472870-222472892 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
922100401 1:222473698-222473720 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
922188946 1:223300124-223300146 GGTCAGAGCAGACCAGGGGCAGG + Intronic
922734249 1:227971042-227971064 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
922788172 1:228293945-228293967 GATGTGAGGAGGCCACAGGAGGG + Intronic
922789742 1:228304921-228304943 GGTGTGAGGAGGCCACAGAGGGG + Intronic
922895196 1:229094596-229094618 GGTCTGAGCAGCGCACTGCCTGG - Intergenic
923529997 1:234805418-234805440 GGTGGGAGCAGGCAACAGACTGG - Intergenic
924343665 1:243055631-243055653 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
924443518 1:244106376-244106398 GGACTGAGAATGCCACAGGTGGG - Intergenic
1065368398 10:24956778-24956800 GTTCCTAACAGGCCACAGGCTGG - Intergenic
1067299068 10:44993074-44993096 GCTCTGTGCAGTCCACAGCCTGG + Intronic
1067945215 10:50684767-50684789 GGTGTGAGCAGGGCCCAGGGTGG - Intergenic
1067945354 10:50685320-50685342 GGGCTGAGAAGGCCCGAGGCAGG - Intergenic
1068630066 10:59289286-59289308 GGTCCTAACAGGCTACAGGCCGG + Intronic
1070652500 10:78247950-78247972 GGTCTTGGCAGGCCAGTGGCAGG - Intergenic
1070783484 10:79150355-79150377 GGTCAGCGCAGGCCAGAGGCAGG - Intronic
1070866725 10:79711639-79711661 GGTGTGAGCAGGGCCCAGGGTGG - Intronic
1070866863 10:79712192-79712214 GGGCTGAGAAGGCCCGAGGCAGG - Exonic
1070880514 10:79849760-79849782 GGTGTGAGCAGGGCCCAGGGTGG - Intronic
1070880653 10:79850313-79850335 GGGCTGAGAAGGCCCGAGGCAGG - Exonic
1071504792 10:86226167-86226189 GGTCTGTGCGGGAAACAGGCAGG - Intronic
1071633775 10:87234415-87234437 GGGCTGAGAAGGCCCGAGGCAGG - Exonic
1071647223 10:87366631-87366653 GGGCTGAGAAGGCCCGAGGCAGG - Exonic
1073267404 10:102236160-102236182 TGTCTGAGCTGGAGACAGGCTGG + Intronic
1074819450 10:117167699-117167721 GATCTGAGCACCACACAGGCCGG - Intergenic
1075379697 10:122008922-122008944 TGTCTGAGCAGGTCACAGCAGGG - Intronic
1076567916 10:131411654-131411676 GGTCTGAGCAGCCCACTGCATGG + Intergenic
1076807042 10:132864055-132864077 GGTGTGTGCAGGTCTCAGGCAGG - Intronic
1076807060 10:132864143-132864165 GGTGTGTGCAGGTCTCAGGCAGG - Intronic
1076807071 10:132864201-132864223 GGTGTGTGCAGGTCTCAGGCGGG - Intronic
1076807097 10:132864314-132864336 GGTGTGTGCAGGTCTCAGGCAGG - Intronic
1076807140 10:132864521-132864543 GGTGTGTGCAGGTCTCAGGCAGG - Intronic
1076807151 10:132864580-132864602 GGTGTGTGCAGGTCTCAGGCAGG - Intronic
1076807163 10:132864639-132864661 GGTGTGTGCAGGTCTCAGGCAGG - Intronic
1076807177 10:132864698-132864720 GGTGTGTGCAGGTCTCAGGCAGG - Intronic
1076807213 10:132864875-132864897 GGTGTGTGCAGGTCTCAGGCAGG - Intronic
1076970541 11:129718-129740 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1077220885 11:1415675-1415697 GGGCAGAGCAGGCCCCGGGCAGG - Intronic
1077370426 11:2179318-2179340 GGGCCGTGCAGGCCACAGGCGGG - Intergenic
1077370647 11:2180207-2180229 TGCCTGAGCAGGCCACCTGCGGG - Intergenic
1077888401 11:6402486-6402508 GGTCTGACCTGCCCACAAGCAGG - Intronic
1080457257 11:32428679-32428701 GGTCTGAACCAGCCACGGGCGGG + Intronic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1081602045 11:44502012-44502034 GCTGTGAGCTGGGCACAGGCTGG - Intergenic
1081668497 11:44930323-44930345 AGTCAGAGCAGTCCAAAGGCAGG - Exonic
1082260400 11:50073233-50073255 GGTCTGTGAAGGCCACAGGGAGG + Intergenic
1082757011 11:57087231-57087253 GGGCTGAGCAGGTCAAAGCCAGG + Intergenic
1083606692 11:63983005-63983027 GGTCTGGGCAGGCACCAGTCTGG + Intronic
1083636324 11:64122817-64122839 GGCCTGAGCAGAGGACAGGCTGG + Intronic
1084377127 11:68785008-68785030 TGTCTGAGCCGGCCGCAGGTTGG + Exonic
1084776379 11:71379522-71379544 GGTCTGAGCTGCCCATTGGCTGG + Intergenic
1084834221 11:71791217-71791239 GCTCTGAGGTGGCCACAGCCTGG - Intronic
1085049062 11:73370585-73370607 GGTCCGGGCTGTCCACAGGCTGG - Intergenic
1085266127 11:75239136-75239158 GGTCTGTGGAGGTAACAGGCTGG - Intergenic
1085382710 11:76134884-76134906 GTTCTTAACAGGCCACAGACGGG - Intronic
1085727438 11:78966553-78966575 GGTCTCAGCAGGGCAGAGGTAGG + Intronic
1088329616 11:108637365-108637387 GGTCAGAGAAGGCCACAGTAAGG + Intergenic
1088558615 11:111089464-111089486 GATCTGTGCAGGAGACAGGCAGG - Intergenic
1088707536 11:112477376-112477398 GAGCTGAGCAGGACTCAGGCTGG - Intergenic
1088918350 11:114243836-114243858 GGTCAGAGCAGGGCACATCCTGG - Intronic
1089258147 11:117204844-117204866 GATCTGCGCAGGGGACAGGCAGG + Exonic
1089330254 11:117684326-117684348 GTTCTGAGCAAGGCACTGGCTGG - Intronic
1089496682 11:118911568-118911590 GCTCTGAGCAGGCTCCTGGCTGG + Intronic
1089625835 11:119750263-119750285 GGCCTGTGAAGGGCACAGGCTGG + Intergenic
1089634484 11:119803577-119803599 GGGCTGGGGAGGACACAGGCAGG + Intergenic
1090351378 11:126110636-126110658 GTTCTGGGCAGGCGTCAGGCAGG - Intergenic
1091283835 11:134397280-134397302 GATCTGAGCAGGTCGCAGGCTGG - Intronic
1092408867 12:8239247-8239269 GCTCTGAGGTGGCCACGGGCTGG + Intergenic
1093353615 12:18135080-18135102 GGTCTGAGGAGACAACAGGTTGG + Intronic
1094010592 12:25805125-25805147 GGGCTGAGCAGGTCAAAGCCAGG - Intergenic
1095088978 12:38086684-38086706 GGTCTCACCAAGCCCCAGGCAGG - Intergenic
1095203080 12:39408414-39408436 GTTCCTAGCAGGCCACAGACTGG + Intronic
1095800142 12:46263596-46263618 GCTCTGAGCAGGAGACAGACAGG - Intronic
1096060480 12:48694530-48694552 GTTCTGGATAGGCCACAGGCAGG + Intronic
1096181735 12:49554860-49554882 GGGCTGAGCAGGGCAGAGACAGG + Intronic
1097622494 12:61957595-61957617 GGACTGAGCAGGCCAAAGACAGG + Intronic
1097794020 12:63843824-63843846 GGACGGAGAAGGGCACAGGCCGG + Intergenic
1098041954 12:66361699-66361721 GCTGTGAGCAGGCAGCAGGCAGG - Intronic
1098658020 12:73057573-73057595 GGTCCTACCAGGCCACAGACTGG - Intergenic
1100202285 12:92312307-92312329 AGTCTAAGCAGGACACTGGCAGG + Intergenic
1101356898 12:103987684-103987706 GGGCTGAGCAGGTCAAAGCCAGG - Exonic
1101374213 12:104157008-104157030 GTTCCTAACAGGCCACAGGCTGG + Intergenic
1101952285 12:109186374-109186396 GGTCTCAGCAGGTCCCAGGTGGG - Intronic
1102002116 12:109563804-109563826 GGCCTGAGCAGGCTCCAGCCTGG + Intronic
1104106572 12:125665622-125665644 GGGGTGAGCAGGCCACCAGCAGG + Intergenic
1104466122 12:128992393-128992415 GTTCCTAACAGGCCACAGGCCGG + Intergenic
1105212004 13:18262393-18262415 TGTCTGAGGAGGGCACAGGAGGG + Intergenic
1105532287 13:21230799-21230821 GGTGTGAGCTGGCCAGTGGCAGG + Intergenic
1108228751 13:48317287-48317309 AGGCTGGGCAGGCCCCAGGCGGG + Intronic
1108361825 13:49674821-49674843 GGGCTGAGCAGGGCAAAAGCTGG - Intronic
1108707808 13:53005958-53005980 GGTCTGAGCGGATCACAGCCAGG + Intergenic
1113398192 13:109968401-109968423 GGGCTTTGCAGGCCACAGGCAGG + Intergenic
1113844532 13:113378973-113378995 GTTCCAAGCAGGGCACAGGCAGG + Intergenic
1113844553 13:113379087-113379109 GTTCCAAGCAGGGCACAGGCAGG + Intergenic
1113896739 13:113769293-113769315 GGACTGTGCAGGCCACAGCCCGG - Intronic
1114863776 14:26561203-26561225 GTTCTTAGCAGGCCACAGACCGG + Intronic
1116043756 14:39717623-39717645 TGTCTGAGCAGGACAGAGACTGG + Intergenic
1116916775 14:50532699-50532721 GTTCTCAGCAGGCCTCAGGGCGG - Intronic
1117554406 14:56869833-56869855 GGTCCTAACAGGCCACAGACTGG - Intergenic
1119623028 14:76147171-76147193 GGCCTGAGCAGGCTGCAAGCAGG - Intergenic
1121859758 14:97306257-97306279 TGTCTGAGAAGCACACAGGCTGG + Intergenic
1122072961 14:99216625-99216647 GGCCTCAGCAGGCCTCAGGATGG + Intronic
1122348879 14:101076534-101076556 GCTCTGTGCCGGACACAGGCAGG - Intergenic
1122352379 14:101103580-101103602 AGCCTGAGCTGGCCAGAGGCAGG - Intergenic
1122719288 14:103713158-103713180 GCTCTGAACAGGCCATGGGCTGG - Intronic
1122724723 14:103742674-103742696 GTGCTGAGAAGGGCACAGGCTGG + Exonic
1123421365 15:20139783-20139805 AGCCAGAGCAGGCCAAAGGCAGG + Intergenic
1123421901 15:20142057-20142079 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
1123443180 15:20304578-20304600 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
1123530591 15:21146323-21146345 AGCCAGAGCAGGCCAAAGGCAGG + Intergenic
1123531129 15:21148597-21148619 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
1127761734 15:62146323-62146345 GCTCTGTGGAGGTCACAGGCAGG - Intergenic
1128556276 15:68633997-68634019 GGTCAGGGCATGTCACAGGCAGG + Intronic
1129661558 15:77555756-77555778 GTGCTGTGCAGGCCCCAGGCTGG - Intergenic
1130890971 15:88133573-88133595 TCTCTAATCAGGCCACAGGCAGG + Intronic
1131341754 15:91608882-91608904 CACCTGAGCAGGGCACAGGCAGG + Intergenic
1132104083 15:99050382-99050404 CGACTGAGCAGGCCACAGTGAGG - Intergenic
1132548967 16:546547-546569 GGGCTGAGCACCCCACAGCCGGG - Intronic
1132583754 16:696988-697010 GTTCTGGGCAGGCCTCACGCCGG - Exonic
1132813868 16:1816844-1816866 GCCCTGAGCAGCCCACAGGAAGG + Intronic
1132831959 16:1932813-1932835 GGGGTGGGCAGGCCACAGGCTGG + Intergenic
1133215935 16:4292563-4292585 GGGCTGACCAGGCCAGAGGAGGG + Intergenic
1133349835 16:5094064-5094086 GCTCTGAGGTGGCCACAGCCTGG + Intronic
1135196973 16:20402847-20402869 GGTCAGGGCAGGCTGCAGGCAGG - Intronic
1136718077 16:32301104-32301126 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
1136773897 16:32861042-32861064 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
1136862942 16:33713627-33713649 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
1136896712 16:34000477-34000499 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
1138298126 16:55904437-55904459 AGTCTGAGAAGGCCAAAGGAAGG + Intronic
1138584957 16:57963553-57963575 GGGCTGGGCTGGCCTCAGGCAGG - Intronic
1139390520 16:66604560-66604582 AGTCTGCGGAGGCCCCAGGCCGG + Intronic
1140207955 16:72948850-72948872 GGTCTGAACTGGCCACAGGATGG - Intronic
1140384706 16:74525418-74525440 GGTATGATCATGCCACAGCCTGG - Intronic
1141623892 16:85251463-85251485 GGGCTCAGCAGGAAACAGGCCGG + Intergenic
1141764741 16:86051113-86051135 GCTCTCAGCAGGCCCCAGGTTGG - Intergenic
1142303171 16:89270614-89270636 AGACTGAGGAGGCCACACGCAGG + Intronic
1142449708 16:90167764-90167786 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1203008351 16_KI270728v1_random:216661-216683 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
1203076317 16_KI270728v1_random:1123153-1123175 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
1203146636 16_KI270728v1_random:1807675-1807697 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
1142457381 17:64081-64103 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1143447520 17:7018147-7018169 GGGCTGAGCAGGCAACTGGAAGG + Intergenic
1143448420 17:7022088-7022110 GGTCTGAGCGCACCCCAGGCCGG + Intergenic
1143492196 17:7290995-7291017 GGTCAGAGCTGGCCCCAGGAGGG + Intronic
1143725357 17:8841323-8841345 GGGATGGGCAGGCCAAAGGCAGG - Intronic
1145307451 17:21683249-21683271 CGTCTGTGCAGGCCTGAGGCTGG + Intergenic
1145800124 17:27677227-27677249 GGTCTCAGCAGATCACAGGATGG + Intergenic
1145974432 17:28976130-28976152 GGTCTGAGCCATCCACAGGGAGG - Intronic
1148381785 17:47205013-47205035 TCTCTGAGCAGGACACAGACAGG + Intronic
1151801894 17:76383925-76383947 GGGTAGAGCAGGCGACAGGCCGG - Intronic
1152449590 17:80368841-80368863 GGACTCAGCAGGCCTCAGCCCGG + Intronic
1152681968 17:81673101-81673123 AGGCAGAGCAGGCCACGGGCAGG + Exonic
1152805681 17:82354679-82354701 GGACAGAGCTGGCCACAGCCGGG + Intergenic
1152882050 17:82823223-82823245 GGTCAGGCCAGGCCACAGCCAGG - Intronic
1152894833 17:82905161-82905183 GGGCGGAGCAGGACAGAGGCAGG - Intronic
1155159234 18:23182434-23182456 GTTCTGTGCAGGCCAAAGGCGGG - Intronic
1157091800 18:44645013-44645035 GGTCTGTTCAGGCCACACACAGG + Intergenic
1157404773 18:47413691-47413713 GGGCTGAGGAGACCTCAGGCAGG - Intergenic
1157541610 18:48514888-48514910 GAGCTGAGCAGGCTCCAGGCTGG + Intergenic
1160530110 18:79557579-79557601 TGGCTGAGCAGGCCAAAGGGGGG + Intergenic
1160565441 18:79784118-79784140 GGTCTGAGGACGCCACAGTTTGG - Intergenic
1160647738 19:201187-201209 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1160798084 19:954889-954911 GATCAGAGCAGGCCCCAGGGAGG + Intronic
1161217245 19:3100684-3100706 GGGCAGCCCAGGCCACAGGCAGG - Intronic
1161323027 19:3649964-3649986 GCTCTGCTCACGCCACAGGCTGG + Intronic
1161551665 19:4916427-4916449 GGTCTCAGGAGGGCACAGGGAGG - Intronic
1162480263 19:10923467-10923489 GGTCTGGGGTGGCCACAGGTGGG - Intronic
1162521194 19:11180562-11180584 GGTATGAGCTGGCCACACCCTGG - Intronic
1162725611 19:12688386-12688408 GGTTTGCCCAGGCCACAGGGTGG - Intronic
1162926034 19:13930892-13930914 GGTCTGAGCAAGAAACAGACAGG - Intergenic
1163447883 19:17358147-17358169 GCCCTGAGCAGCCCACAGGGAGG - Intronic
1163710933 19:18846360-18846382 GGTCTGAGGAGGCCAAAGGAAGG - Intronic
1163738603 19:18996969-18996991 GGTCTGAGCAGGGGACAGGTGGG + Intronic
1164925162 19:32124575-32124597 GGTCAGGGGAGGCCACAGGGCGG + Intergenic
1165091990 19:33392486-33392508 GGTTTGGGCAGGCCACGTGCTGG + Intronic
1165122959 19:33574194-33574216 AGGCTGAGCAAGCAACAGGCTGG - Intergenic
1166141672 19:40808523-40808545 GACCTCAGCAGGCCACTGGCTGG + Intronic
1166293572 19:41878285-41878307 GGCCAGGGCAGGCCACAGACTGG + Intronic
1166751283 19:45165063-45165085 GGGCTGGGCAGGCCCCGGGCGGG - Intronic
1167291688 19:48628381-48628403 GGGGTGAGCATCCCACAGGCAGG - Intronic
1167473372 19:49687314-49687336 GGTCTGAGCAGGCAGGAGGATGG + Intronic
1167896665 19:52587331-52587353 GGAGTGAGGAGGACACAGGCAGG - Intergenic
1167906112 19:52662011-52662033 GGAGTGAGGAGGACACAGGCAGG + Intronic
1167945112 19:52981853-52981875 GGAGTGAGGAGGACACAGGCAGG + Intergenic
1168598206 19:57696019-57696041 GGTCTGAGGAAGCCGAAGGCAGG + Intronic
1202691014 1_KI270712v1_random:95938-95960 AGCCAGAGCAGGCCAAAGGCAGG + Intergenic
1202691639 1_KI270712v1_random:98503-98525 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
925029588 2:639183-639205 GTTCCTAACAGGCCACAGGCTGG + Intergenic
925580090 2:5401443-5401465 AGTCTGGGCAGGCGCCAGGCTGG + Intergenic
925753874 2:7115025-7115047 GGTCTCAGCACACCCCAGGCAGG - Intergenic
926299954 2:11595461-11595483 AGCCTTAGCAGGTCACAGGCAGG - Intronic
927507863 2:23626353-23626375 GTTCCTAACAGGCCACAGGCTGG + Intronic
928171854 2:29009481-29009503 TGGCTGAGCAGGGCAGAGGCAGG + Intronic
928359026 2:30648108-30648130 GGAGTGAGCAGGGCACAGACAGG + Intergenic
930948390 2:57105837-57105859 GTTCCTAGCAGGCCACAGACAGG - Intergenic
931145768 2:59515862-59515884 GGTCTGAGCAGACAAAATGCTGG + Intergenic
931516894 2:63055351-63055373 GGTCTGGCCAGGCCAGAGACAGG + Intronic
932575917 2:72962292-72962314 GGGCTGACCATGCCACAGGCAGG + Intronic
932585573 2:73025966-73025988 GCTCTGAGGACACCACAGGCAGG + Intronic
933954749 2:87355447-87355469 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
933955380 2:87358013-87358035 AGCCAGAGCAGGCCAAAGGCAGG - Intergenic
934238945 2:90251673-90251695 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
934239566 2:90254224-90254246 AGCCAGAGCAGGCCAAAGGCAGG - Intergenic
934273627 2:91562517-91562539 AGCCAGAGCAGGCCAAAGGCAGG + Intergenic
934274249 2:91565037-91565059 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
934301622 2:91780015-91780037 TGTCTGAGGAGGGCACAGGAGGG - Intergenic
934462005 2:94217564-94217586 AGCCAGAGCAGGCCAAAGGCAGG - Intergenic
934680157 2:96277992-96278014 GGCCTGAGCTGGTCTCAGGCAGG - Intronic
934927948 2:98395005-98395027 GGACAGAGCAGGCAGCAGGCAGG - Intronic
936755943 2:115712413-115712435 GTTCTTAACAGGCCACAGACTGG + Intronic
937086929 2:119178002-119178024 TCTCTGAGGATGCCACAGGCAGG - Intergenic
937322116 2:120967038-120967060 GGTCTGAGCAGGCAGAAGGGAGG + Intronic
938583437 2:132668630-132668652 GGTCTAAGCCTGCCAGAGGCTGG - Intronic
940090840 2:149915190-149915212 GCTCTGAGCAGGGCCCAGGCAGG - Intergenic
942930480 2:181486527-181486549 ATTCTGAGCAGGCCACTGGGAGG + Intronic
945027415 2:205632317-205632339 GTTCTCAACAGGCCACAGACGGG - Intergenic
946153590 2:217792638-217792660 GGGCTTTGCAGGCCACAGGAAGG - Intergenic
946308900 2:218872030-218872052 GGTCTGAGAAGGCCAGATGCTGG + Intronic
946806397 2:223475016-223475038 GTTCTTAGCAGGCCACAGACTGG - Intergenic
947218727 2:227772514-227772536 GTTCCCAGCAGGCCACAGACTGG - Intergenic
948776611 2:240292350-240292372 GGTCAGTGCAGGAGACAGGCAGG + Intergenic
1168859681 20:1036975-1036997 GGGCCAAGCAGGCCGCAGGCAGG + Intergenic
1170907365 20:20528290-20528312 GACCTGTGCAGCCCACAGGCTGG - Intronic
1171807174 20:29690042-29690064 CGTCTGGGCAGGCCTGAGGCTGG - Intergenic
1171837192 20:30168124-30168146 GGTCCGGGCAGGCCTGAGGCTGG + Intergenic
1171846752 20:30281972-30281994 GGTCCGGGCAGGCCTGAGGCTGG - Intergenic
1173471885 20:43330325-43330347 GGTAGGAGGAGGCCAGAGGCCGG + Intergenic
1174988745 20:55485911-55485933 AGTCTGATCAAGCCACATGCAGG - Intergenic
1176146682 20:63568571-63568593 GGTCTGGGCAGGGCGCAGGTGGG + Exonic
1179354752 21:40648987-40649009 GGGCTGAGCAAGGCCCAGGCAGG + Intronic
1179512624 21:41883999-41884021 GGACTGAGCAGGACACTGGAGGG - Intergenic
1179717655 21:43298047-43298069 GGCCTGAGCAGGGCATGGGCAGG + Intergenic
1181345295 22:22215703-22215725 GGCATGAGCAGGCCACAGAAGGG - Intergenic
1181354865 22:22291741-22291763 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
1182555296 22:31125720-31125742 GGCCTGAGGGGGCCCCAGGCCGG - Exonic
1183218364 22:36495922-36495944 GGTCTGAGGAGCCCACAGGTTGG + Intronic
1183582109 22:38732186-38732208 GGTCTGATCAGTCCACGGCCAGG - Exonic
1184767728 22:46580314-46580336 GGTTTGGGCATCCCACAGGCTGG + Intronic
1185287802 22:50010356-50010378 GATCCGAGCAGGCCTCAGGTGGG + Intronic
1185389528 22:50551419-50551441 GGACTGGTCAGGCCACAGGGAGG + Intronic
950714482 3:14838019-14838041 GGTCTCAGGAGGCCAAAGTCAGG + Intronic
950831181 3:15877922-15877944 GGGCTGGGCAGGCCAGGGGCGGG - Intergenic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
951445183 3:22771084-22771106 GGTATGAACAGGGCACAGGTGGG + Intergenic
952257868 3:31710988-31711010 GGTCTCAGCATTCAACAGGCTGG + Intronic
952788032 3:37175865-37175887 TGTCTGAGAACGCCGCAGGCAGG + Intronic
953234074 3:41090934-41090956 GTTCCGAGCAGGCCCCATGCAGG - Intergenic
953718555 3:45336082-45336104 GGACTGAGCATACCAAAGGCAGG + Intergenic
953998107 3:47536191-47536213 GGCCTGAGCTACCCACAGGCTGG - Intergenic
954263340 3:49455634-49455656 GGTCTGAGAAGGCCACATGGAGG - Intergenic
954611832 3:51948369-51948391 ACTCTGGGCAGGGCACAGGCTGG - Exonic
961300701 3:125920299-125920321 GCTCTGAGGTGGCCACGGGCTGG - Intergenic
961491186 3:127257766-127257788 TGTTTGGGCAGGGCACAGGCCGG + Intergenic
961887801 3:130107789-130107811 GCTCTGAGGTGGCCACAGGCTGG + Intronic
962388612 3:134953314-134953336 GTTCTCAGCAGGCCTCAGGAAGG - Intronic
962629396 3:137260455-137260477 GGTCTGAGCTGGGCACAGGTAGG + Intergenic
963307524 3:143669701-143669723 GGTCTGATCAGAACACAGGTTGG - Intronic
966358481 3:179107865-179107887 GTTCTTAACAGGCCACAGACTGG + Intergenic
966589393 3:181664142-181664164 AGTCTGAGCAAGTCACAGGAAGG + Intergenic
967887115 3:194341004-194341026 GGCCTGACCAGGCGACAGGTAGG - Exonic
968091470 3:195900867-195900889 GGCCTGAGCTGGCAGCAGGCAGG - Intronic
968370109 3:198218928-198218950 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
968439266 4:613332-613354 GGTCTGAGCAGGCACCATGGTGG - Intergenic
968910994 4:3476965-3476987 GCTCTGGGCGGCCCACAGGCGGG - Intronic
968975852 4:3821735-3821757 GGTCTCAGCAGGGGCCAGGCTGG + Intergenic
969757069 4:9156959-9156981 GCTCTGAGGTGGCCACGGGCTGG - Intergenic
969817028 4:9694534-9694556 GCTCTGAGGTGGCCACAGCCTGG - Intergenic
971359446 4:25923223-25923245 GGTCTGAAGAGGCCACAGTTAGG + Intronic
972027654 4:34405536-34405558 GATCCTAGCAGGCCACAGGCTGG + Intergenic
979259415 4:118633942-118633964 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
979292586 4:118994132-118994154 GGTCTTAGGAGGCCACACGTTGG - Intronic
979328938 4:119406621-119406643 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
984923313 4:184784807-184784829 TGGCTGAGGAGGACACAGGCTGG + Intronic
985584577 5:723637-723659 GCTAAGAGAAGGCCACAGGCGGG + Intronic
985598084 5:807967-807989 GCTAAGAGAAGGCCACAGGCGGG + Intronic
986350028 5:6868693-6868715 GCTATGAGCAGGCAACTGGCAGG - Intergenic
986674551 5:10171610-10171632 GGTCTGAGAGGTCCATAGGCAGG - Intergenic
988013090 5:25515791-25515813 GTTCTCAACAGGCCACAGACTGG + Intergenic
988099085 5:26655506-26655528 GGTCGGAGAAGGTCACAGGAGGG + Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
990397219 5:55394660-55394682 GTTCTTAACAGGCCACAGACTGG + Intronic
994329179 5:98486301-98486323 GCTCTGAGAAGGCCTCTGGCAGG - Intergenic
997443364 5:133924549-133924571 GGTCTGATCAGAGCACAGCCAGG - Intergenic
997693850 5:135845994-135846016 GTTCCTAACAGGCCACAGGCTGG - Intronic
999158357 5:149474523-149474545 GCTCTGCTCAGGGCACAGGCGGG - Intergenic
999366344 5:151026220-151026242 GGGCTGAGCAGTCTACTGGCAGG + Intronic
1001247317 5:170114513-170114535 GCTCTGAGGAGGGCAGAGGCAGG - Intergenic
1001256047 5:170184182-170184204 GGGCTGAGCCGGCTTCAGGCGGG - Intergenic
1001287592 5:170435181-170435203 GGGCAGCACAGGCCACAGGCTGG + Intronic
1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG + Intergenic
1002253628 5:177944019-177944041 GGTAGGAGCAGGGCGCAGGCGGG - Intergenic
1002290089 5:178194469-178194491 GGTCTGATTAGACCAAAGGCTGG + Intergenic
1002606052 5:180383390-180383412 GGCTTAGGCAGGCCACAGGCAGG + Intergenic
1002729634 5:181325686-181325708 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1003062651 6:2875353-2875375 GGTCAGGGCAGGCCCCGGGCCGG + Intergenic
1003154874 6:3583931-3583953 TGTGTGAGGAGGGCACAGGCTGG - Intergenic
1004187406 6:13432710-13432732 GATGTGCACAGGCCACAGGCTGG - Intronic
1004276144 6:14236629-14236651 GGTCAGAGCAGGAAACAAGCAGG + Intergenic
1004875219 6:19944560-19944582 GTTCTCAACAGGCCACAGACTGG + Intergenic
1006457515 6:34140420-34140442 GGTTTGAGCACAGCACAGGCAGG + Intronic
1006677630 6:35775892-35775914 GGTGTGAGCAGCCCAGAGGGTGG + Intergenic
1006797127 6:36738893-36738915 GCCCTGAGCAGGCCAGAGGGAGG - Intergenic
1006818003 6:36866489-36866511 TGACTGAGCAGCCCACTGGCAGG - Intronic
1007505811 6:42334604-42334626 GTTCTGAGCAGGGAACAGGGTGG + Intronic
1007607900 6:43129676-43129698 GGGCAGAGCAGGGCAAAGGCGGG - Intronic
1007638227 6:43314042-43314064 GGTCTGTGCAGGAAAAAGGCAGG - Intronic
1008950834 6:57156993-57157015 GTTCTTAACAGGCCACAGACTGG + Intronic
1015066805 6:129039889-129039911 GTTCCTAACAGGCCACAGGCTGG + Intronic
1017519201 6:155186607-155186629 GGGCTGAACATGCCACAGACAGG - Intronic
1018632924 6:165835810-165835832 GGGCTGAGCAGGACCCAGGAAGG + Intronic
1018958281 6:168427948-168427970 GGAGTGAGCAGGGCACAGGGTGG + Intergenic
1019409738 7:901277-901299 GGTCTGGGCAGACCCCAGGAGGG - Intronic
1019478451 7:1255237-1255259 CCTCAGAGCAGGCCCCAGGCCGG - Intergenic
1020261128 7:6531287-6531309 GGTCCCAGCAGGGCAGAGGCGGG - Intronic
1021749979 7:23787448-23787470 GTTCTTAACAGGCCACAGACTGG - Intronic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1023041371 7:36175910-36175932 GGGCTGAGCAGGTCACTGCCGGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024074314 7:45810939-45810961 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1024649006 7:51389188-51389210 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1025028901 7:55539743-55539765 GGACAGAGGTGGCCACAGGCAGG + Intronic
1025053101 7:55744589-55744611 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1025176183 7:56803596-56803618 GGTCTGTGCAGGCCACCGCGAGG + Intergenic
1025178296 7:56812776-56812798 GGCCTGAAAAGGCCACTGGCAGG + Intergenic
1025178727 7:56814518-56814540 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1025179164 7:56816308-56816330 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1025179621 7:56818194-56818216 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1025180071 7:56820032-56820054 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1025180542 7:56822014-56822036 GGCCTGAAGAGGCCACTGGCAGG + Intergenic
1025180989 7:56823861-56823883 GGCCTGAAGAGGCCACTGGCAGG + Intronic
1025181416 7:56825603-56825625 GGCCTGAAGAGGCCACTGGCAGG + Intronic
1025181862 7:56827441-56827463 GGGCTGAAGAGGCCACTGGCAGG + Intergenic
1025268220 7:57485210-57485232 CGTCTGGGCAGGCCTGAGGCTGG - Intergenic
1025301509 7:57822245-57822267 CGTCTGGGCAGGCCTGAGGCTGG - Intergenic
1025690500 7:63751377-63751399 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025690948 7:63753200-63753222 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025691387 7:63754976-63754998 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1025691824 7:63756799-63756821 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025692272 7:63758622-63758644 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025692719 7:63760445-63760467 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1025693134 7:63762124-63762146 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025693579 7:63763947-63763969 GGCCTGAGGAGGCCACTGGCAGG - Intergenic
1025694042 7:63765853-63765875 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1027486925 7:78773138-78773160 TTTCTGAGAAGACCACAGGCAGG + Intronic
1027487051 7:78774685-78774707 TTTCTGAGAAGACCACAGGCAGG + Intronic
1028496207 7:91463633-91463655 GGGCTGAGCCAGGCACAGGCAGG + Intergenic
1029034396 7:97503588-97503610 GTTCTTAACAGGCCACAGACCGG - Intergenic
1029125877 7:98295027-98295049 GGTGTGGCCGGGCCACAGGCTGG - Intronic
1029188544 7:98755994-98756016 GGTCTGATCAGGCCTCCTGCTGG + Intergenic
1030150322 7:106398155-106398177 ACTCTGAGCAGGCCAGTGGCAGG + Intergenic
1032051356 7:128652807-128652829 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1032431054 7:131861838-131861860 GGGCTGGGCAGGCCCCAGGCAGG - Intergenic
1033317856 7:140313275-140313297 GCTCAGAGCAGGGCCCAGGCAGG + Intronic
1033360800 7:140637763-140637785 GGTCTGAGAAGGGGACAGGTAGG - Intronic
1034331484 7:150287007-150287029 GGTCCCAGCATGCCACAAGCCGG + Intronic
1034666559 7:152822854-152822876 GGTCCCAGCACGCCACAAGCCGG - Intronic
1035473474 7:159126602-159126624 GGTGTGAGACGGCCACATGCTGG + Intronic
1035818295 8:2563986-2564008 GATCTGAGCATGGCAGAGGCTGG - Intergenic
1036380299 8:8232274-8232296 GCTCTGAGGTGGCCACGGGCTGG - Intergenic
1036427193 8:8655525-8655547 GCGCTGGGCAGGACACAGGCTGG + Intergenic
1036849261 8:12190386-12190408 GCTCTGAGGTGGCCACGGGCTGG + Intronic
1036870621 8:12432660-12432682 GCTCTGAGGTGGCCACGGGCTGG + Intronic
1037101762 8:15055588-15055610 GGACTGAGAAGGCCAGAGCCTGG + Intronic
1037498668 8:19464562-19464584 GTTCTGAACAGGCCACGGACTGG - Intronic
1037829046 8:22177429-22177451 GGCCTGAGCAGTCCCCAGGACGG - Intronic
1039595506 8:38787296-38787318 GGCCTGAGGAGGCCACAGGACGG + Exonic
1040551984 8:48444883-48444905 GGTGTGAGCAGGGGCCAGGCTGG + Intergenic
1041051452 8:53938915-53938937 GGTCCGGGCAGGCCACAGTCTGG + Intronic
1042939016 8:74088994-74089016 CCTCTCACCAGGCCACAGGCTGG - Intergenic
1043775345 8:84260441-84260463 TGTCTGAGCAGGCCACATAGAGG - Intronic
1044586791 8:93875895-93875917 GTTCATAACAGGCCACAGGCTGG + Intronic
1045305580 8:100953329-100953351 GGTGGGAGTGGGCCACAGGCCGG + Intronic
1046907261 8:119587003-119587025 GGCCTGGGCAGGGCAGAGGCGGG + Intronic
1047249201 8:123169039-123169061 CATCTGAGCAGGTCACATGCAGG - Intergenic
1048583415 8:135749934-135749956 GTTCTTAACAGGCCACAGACAGG - Intergenic
1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG + Intronic
1049846959 8:144807420-144807442 GGGCTGAGCTCCCCACAGGCCGG - Exonic
1050581434 9:7061612-7061634 GCTCTGAGGAGCCCACAGCCAGG - Intronic
1051689571 9:19695989-19696011 GTTCTTAACAGGCCACAGACTGG - Intronic
1052004012 9:23324413-23324435 GGAGTGAGCGGACCACAGGCTGG - Intergenic
1053313181 9:37032300-37032322 GGTCTGCGCAGTCCTCGGGCTGG - Intronic
1053421627 9:37983494-37983516 GAGCTGGGCAGGACACAGGCTGG + Intronic
1053691852 9:40590647-40590669 GGTCTGGGCAGGACTAAGGCAGG - Intergenic
1053692482 9:40593247-40593269 AGCCAGAGCAGGCCAAAGGCAGG - Intergenic
1054272335 9:63044286-63044308 AGCCAGAGCAGGCCAAAGGCAGG + Intergenic
1054272951 9:63046844-63046866 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
1054303109 9:63391613-63391635 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
1054303724 9:63394165-63394187 AGCCAGAGCAGGCCAAAGGCAGG - Intergenic
1054401888 9:64718123-64718145 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
1054402502 9:64720675-64720697 AGCCAGAGCAGGCCAAAGGCAGG - Intergenic
1054435494 9:65202438-65202460 GGTCTGGGCAGGACCAAGGCAGG - Intergenic
1054436112 9:65205006-65205028 AGCCAGAGCAGGCCAAAGGCAGG - Intergenic
1054447737 9:65385814-65385836 CGTCTGTGCAGGCCTGAGGCTGG - Intergenic
1054494280 9:65816681-65816703 AGCCAGAGCAGGCCAAAGGCAGG + Intergenic
1054494899 9:65819249-65819271 GGTCTGGGCAGGACCAAGGCAGG + Intergenic
1056383736 9:86078565-86078587 GGGCTGGGCAGGCCAAAGACAGG + Intronic
1057081461 9:92177228-92177250 GGGCTGCGCAGGGCCCAGGCAGG + Intergenic
1057276407 9:93678063-93678085 AGTCAGAGCTGGCCACAGGCTGG + Exonic
1057484195 9:95469356-95469378 AGTCTGAGGAGGCCACATGGAGG + Intronic
1058024379 9:100124982-100125004 GGCCTGAGCAGCCCAGAGGTGGG - Intronic
1059958435 9:119542282-119542304 GCTCTTAGCAAACCACAGGCTGG - Intergenic
1059974180 9:119698191-119698213 GGTGTGAGCATGTCACAGCCAGG - Intergenic
1060213560 9:121724932-121724954 GGTCTGAGAGGGCCAGGGGCAGG + Intronic
1060917999 9:127402743-127402765 GGGCTGAGCAGGTGAGAGGCTGG + Exonic
1061178867 9:129012568-129012590 TGCCTGAGCAAGTCACAGGCTGG + Intronic
1062025395 9:134337997-134338019 GCTCTGAGGATGCGACAGGCAGG + Intronic
1062039320 9:134396836-134396858 GGTCTGAGCAGGCCACAGGCTGG - Intronic
1062120785 9:134832989-134833011 TTTCGGAGCAGGCCAGAGGCAGG + Intronic
1062192837 9:135256517-135256539 GGCCTGGGCAGGCCAGAGGCGGG - Intergenic
1062491754 9:136808225-136808247 GGTCGGACCAGGCCCCGGGCCGG + Exonic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062754049 9:138278198-138278220 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1203577604 Un_KI270745v1:20955-20977 GGCCTGAAGAGGCCACTGGCAGG - Intergenic
1203666499 Un_KI270754v1:23426-23448 GGTCCGTGCAGGCCTGAGGCTGG + Intergenic
1203667648 Un_KI270754v1:29065-29087 GGTCCGTGCAGGCCTGAGGCTGG + Intergenic
1189002016 X:36957744-36957766 GGTCTGCGGAGGCCGCCGGCCGG - Intergenic
1190480355 X:50870794-50870816 GGCCTGAGCTGGCCACAGGATGG - Intergenic
1191887616 X:65905070-65905092 GACCTCAGCAGGCAACAGGCTGG - Intergenic
1199710697 X:150467089-150467111 AGTCTGAGCTGGCAACAGTCAGG - Intronic
1200115862 X:153769459-153769481 GGGATGAGGAGTCCACAGGCCGG - Intronic
1200151545 X:153953768-153953790 GGTCTGTGGGGGCGACAGGCAGG + Exonic
1200238167 X:154479085-154479107 GGTCTCAGAAGGCCCCCGGCAGG - Exonic