ID: 1062040301

View in Genome Browser
Species Human (GRCh38)
Location 9:134401499-134401521
Sequence GACCCACGGGGCCACCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062040296_1062040301 14 Left 1062040296 9:134401462-134401484 CCGTAGTGAGTGTGAATTTGCGT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1062040301 9:134401499-134401521 GACCCACGGGGCCACCTTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 118
1062040295_1062040301 15 Left 1062040295 9:134401461-134401483 CCCGTAGTGAGTGTGAATTTGCG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1062040301 9:134401499-134401521 GACCCACGGGGCCACCTTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 118
1062040294_1062040301 20 Left 1062040294 9:134401456-134401478 CCTGGCCCGTAGTGAGTGTGAAT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1062040301 9:134401499-134401521 GACCCACGGGGCCACCTTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062040301 Original CRISPR GACCCACGGGGCCACCTTGA GGG Intronic
901896738 1:12319960-12319982 GACCCACGGCCTCACCTTCATGG - Intronic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
906581580 1:46939688-46939710 GACCCAGGAGGCCTTCTTGAAGG + Intronic
907790383 1:57658115-57658137 CACACATGGGGCCACCTTGGAGG + Intronic
911746533 1:101447342-101447364 GGCCCAGGTGGCCACCTTCAGGG + Intergenic
921257694 1:213357222-213357244 GACACACGGGCCCACCTTTGAGG - Intergenic
922749514 1:228064002-228064024 GACCCAGGGGGCCATCTGGGTGG + Intergenic
1066747473 10:38615712-38615734 GACCCCGGGGGCCACCGCGAAGG - Intergenic
1069043696 10:63721043-63721065 GATCCTTGGGGCCATCTTGAAGG + Intergenic
1073288954 10:102403949-102403971 GACCCACGAGGCCAAGCTGAAGG - Exonic
1076385767 10:130053968-130053990 GACCCACGGTGGCACTTGGAGGG - Intergenic
1077155783 11:1090249-1090271 GACCCATGGGGACACCCGGAGGG + Intergenic
1078085710 11:8232025-8232047 GAGCCCTGGGGCCAGCTTGACGG - Intronic
1078660079 11:13278661-13278683 GACCCACGGGGCATCCTTGAGGG - Intronic
1084301539 11:68255682-68255704 GACCCTAGGGGCCACTTTGGAGG - Intergenic
1084590392 11:70086718-70086740 GACCCTCGGAGTGACCTTGAAGG - Intronic
1096131011 12:49159032-49159054 GACCCAAGTGGGCAACTTGAAGG + Intergenic
1096195909 12:49648733-49648755 GACCTCTGGGGCCAGCTTGAGGG + Intronic
1103719758 12:122966751-122966773 GAGCCACGGGCCCATCCTGAGGG + Intronic
1104111708 12:125710629-125710651 GGCCCACATTGCCACCTTGAAGG - Intergenic
1104718484 12:131031675-131031697 GACCCCCAGGGCCACCTCCATGG + Intronic
1104919666 12:132283917-132283939 GACCCCCGAGACCACCTTGACGG - Intronic
1105409821 13:20161781-20161803 GACCCGCGGGGACACCTTCCCGG - Intergenic
1106881001 13:34130236-34130258 GTCCTTCGGGGCCACCTGGATGG - Intergenic
1110706259 13:78603693-78603715 GACGCACGGGGCCGCCGAGAAGG - Intergenic
1111351795 13:87041113-87041135 GACCCAAGTGGGCAACTTGATGG + Intergenic
1121839465 14:97120671-97120693 GACCCACAGGGCCCCCTTCCTGG + Intergenic
1122846935 14:104505329-104505351 TAGCCACTGGGCCACCTGGAAGG + Intronic
1123947231 15:25244687-25244709 GAGCCACGGGGTCACCTCCAGGG + Intergenic
1123948052 15:25248420-25248442 GAGCCACGGGGTCACCTCCAGGG + Intergenic
1129656601 15:77528955-77528977 GGCCCCCAGGGCCTCCTTGATGG + Intergenic
1130994235 15:88895207-88895229 GACCCTCGTGCCCACCGTGAGGG - Intronic
1132566451 16:625706-625728 GAGCTACGGGGCCACCCGGAAGG + Intronic
1132692127 16:1186278-1186300 GCCCCACTGGGACACCTCGAGGG - Intronic
1135636301 16:24078490-24078512 GACCCTCAGGGCCAACCTGAGGG + Intronic
1136735333 16:32461881-32461903 GACCCGGGGGGCCACCGCGAAGG + Intergenic
1138292126 16:55856672-55856694 GGCCCAAGTGGCCACCTTGTGGG + Intronic
1138723522 16:59110399-59110421 GACCCAAGTGGGCAACTTGAAGG + Intergenic
1203017750 16_KI270728v1_random:367710-367732 GACCCGGGGGGCCACCGCGAAGG - Intergenic
1203036085 16_KI270728v1_random:640868-640890 GACCCGGGGGGCCACCGCGAAGG - Intergenic
1142669418 17:1480870-1480892 CACCCACGGGGGCACCCTGTGGG + Exonic
1143594104 17:7903951-7903973 GACGTACTGTGCCACCTTGAAGG - Exonic
1144768199 17:17744341-17744363 GACCCTCATGGCCACCCTGAGGG - Intronic
1146482344 17:33214726-33214748 GACCTAAGGGGTCACCTGGAGGG + Intronic
1152063734 17:78098445-78098467 CACCCACGAGGCCACCTCCAGGG + Exonic
1154422056 18:14240249-14240271 GATCCACGTGGCCACGATGACGG + Intergenic
1159014268 18:63088687-63088709 GTCCTACGGGGTCACCTTCAGGG + Intergenic
1160491126 18:79337319-79337341 GACTACCGCGGCCACCTTGAGGG - Exonic
1160921990 19:1525360-1525382 GCCACACGGCACCACCTTGAGGG - Exonic
1160970626 19:1766335-1766357 CACCCACGGGCCCGCCTTCAGGG + Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1163648339 19:18502868-18502890 AAACCACGGGGCCACCTGGCCGG + Intronic
1165793343 19:38505241-38505263 GACACACGGGGCGACCCTGGAGG - Intronic
925274700 2:2640521-2640543 GACCCACGGTGCCATCTTTGGGG - Intergenic
927865524 2:26585088-26585110 TTCCCACAGAGCCACCTTGAGGG + Intronic
929769372 2:44879065-44879087 GAGCCACGGGTCCACCTTCCGGG + Intergenic
929789704 2:45013792-45013814 GACCCACGCGGCAGCCTGGAGGG + Intergenic
930022243 2:47008501-47008523 CACTCCCGGGGCCACCTTGCTGG - Intronic
934046039 2:88173178-88173200 GCCCCACGGGTCAACTTTGAGGG + Exonic
935274673 2:101465854-101465876 CACCCTTGGGGCCACCTTTAAGG + Intronic
938070015 2:128303350-128303372 CACCCATGGGGCCACCCTGAGGG + Intronic
942299344 2:174547095-174547117 GTCCAACAGGGCCACCTAGAGGG + Intergenic
947596150 2:231412857-231412879 GACCCTCAGGGCCACCTTAGGGG + Intergenic
948664013 2:239523463-239523485 AACACAGGGGGCCATCTTGATGG - Intergenic
949009396 2:241669983-241670005 GACCAAAGGGGCCACCTGGTGGG + Intronic
1168823461 20:792870-792892 GACCTAGGGGGCCATCTGGAGGG - Intergenic
1171343151 20:24446087-24446109 CACCCACTGGGCCACCTTCTTGG - Intergenic
1176385817 21:6138150-6138172 GACCCACAGGGCCTGCTTGGCGG - Intergenic
1179058126 21:37954766-37954788 GACACAGGCGGCCACCTCGAGGG - Intronic
1179085050 21:38208399-38208421 TACACACGGGGACAGCTTGAAGG - Intronic
1179737656 21:43400102-43400124 GACCCACAGGGCCTGCTTGGCGG + Intergenic
1183363752 22:37396501-37396523 GACCCTCTGGGGCACTTTGAAGG + Intronic
1184588159 22:45461766-45461788 GACCCAGGGAGCCAGCATGATGG + Intergenic
1185169779 22:49286053-49286075 CACCCTGGGGGCCACCTTCATGG + Intergenic
950177034 3:10882091-10882113 GACGAATGGGGCCACCATGAAGG - Intronic
954105544 3:48407881-48407903 GACCCGCAGGGCCACCTCCAGGG - Intronic
961150773 3:124636199-124636221 AACCCAAGGGGCAAACTTGAAGG + Intronic
961505112 3:127365507-127365529 GACCCAAGGTGGCACATTGAAGG - Intergenic
962289732 3:134123887-134123909 GGCCCAAGGTGCCACCTTGAGGG - Intronic
967847366 3:194054903-194054925 GACCCACTGGGGCAACTTCAGGG - Intergenic
969873013 4:10116445-10116467 GGCCCACGGCGCCAACTTGGGGG + Intronic
969881387 4:10177105-10177127 GGCCCTAGGGGCTACCTTGAAGG - Intergenic
972357927 4:38298511-38298533 GACCCTCAGGGCCACCCTCATGG + Intergenic
974664240 4:64937380-64937402 GACCCAAGTGGGCAACTTGAAGG + Intergenic
984567202 4:181345407-181345429 AACCCACGGGGTCACTTTGAAGG + Intergenic
989187082 5:38636071-38636093 GACCCAGGTGGCCACCTCCAGGG - Intergenic
990639210 5:57762606-57762628 TAGCCACAGGGCCACCTTCATGG + Intergenic
992607379 5:78472658-78472680 GACCCAGAGAGCCACCTAGAGGG - Intronic
997473114 5:134127676-134127698 GCCCCACTGGGGCACGTTGAGGG + Intronic
1001724959 5:173888811-173888833 GACCGAGGGGGCGACCTGGAAGG - Exonic
1004365941 6:15012762-15012784 GCAACAAGGGGCCACCTTGAAGG + Intergenic
1005433766 6:25786516-25786538 GGCCCAAGGGACCACCTAGAAGG + Intronic
1006387069 6:33737153-33737175 GACCCACAGGCCCACCCTCAGGG - Intronic
1007101925 6:39254625-39254647 GACACAAGGGGCCAGCTTGAAGG - Intergenic
1007119909 6:39371231-39371253 TTCTCACGGGGCCACCTAGAGGG + Intronic
1011288391 6:85749473-85749495 GACCCAAGAGGGCAACTTGAAGG - Intergenic
1011549784 6:88520595-88520617 GACACACGTGGCCATCTGGAAGG + Intergenic
1011655967 6:89552355-89552377 GACCCTCAGGGCCTCCCTGATGG + Intronic
1012001144 6:93656570-93656592 GACACCCGGGGCCTACTTGAAGG - Intergenic
1018427239 6:163694498-163694520 GCCCAACAGGGCCACCTAGAAGG + Intergenic
1019155984 6:170039305-170039327 GACGCAGGGGACCACCCTGATGG - Intergenic
1020178146 7:5898964-5898986 GAACCACAGGGCCACCTTCCCGG - Intronic
1020304781 7:6826011-6826033 GAACCACAGGGCCACCTTCCCGG + Intronic
1031836287 7:126685222-126685244 CACCCTGGGGGCCACCATGATGG + Intronic
1031893340 7:127320616-127320638 GACCCACTGGGCCATCAAGAGGG - Intergenic
1032483113 7:132262500-132262522 CAGCCATGGGACCACCTTGAAGG - Intronic
1035578911 8:727800-727822 GCACCACTGGACCACCTTGATGG + Intronic
1038075443 8:24067617-24067639 CAAACACTGGGCCACCTTGAGGG - Intergenic
1038404787 8:27313470-27313492 GACCCAAGCGGGCAACTTGAGGG + Intronic
1039792787 8:40888760-40888782 GACCCAGAGGGCCACCTCGGGGG + Intronic
1049388237 8:142354945-142354967 GGACCAAGAGGCCACCTTGAAGG - Intronic
1049390146 8:142363526-142363548 GGACCAAGAGGCCACCTTGAAGG - Intronic
1058670976 9:107360162-107360184 AACCCACGGGACCATCTTGCAGG - Intergenic
1059892003 9:118814212-118814234 GACCCAGGTGGCCACCTTAAAGG + Intergenic
1062040301 9:134401499-134401521 GACCCACGGGGCCACCTTGAGGG + Intronic
1203768157 EBV:37165-37187 TACCCTCGGGGCCACCATGGTGG + Intergenic
1203786723 EBV:132356-132378 CACCCACTGGCCCCCCTTGATGG - Intergenic
1186760677 X:12718633-12718655 CAACCACGGAGCCACCTTTAAGG + Exonic
1188881157 X:35493393-35493415 GACCCAAGCGGGCAACTTGAAGG - Intergenic
1189510397 X:41656099-41656121 GACCCAGGTGGCCACCTCGAGGG - Intronic
1190705933 X:53028214-53028236 GACCCAGGTGGCCACCTCAAAGG - Intergenic
1192381192 X:70618370-70618392 GACCCAGGGGGCCGCCTCAAGGG - Intronic
1194320188 X:92436797-92436819 GACAAAGGGGGCCTCCTTGAGGG + Intronic
1200243925 X:154512764-154512786 GGCCCAGGTGGCCACCTTGGTGG + Intronic
1200628310 Y:5549929-5549951 GACAAAGGGGGCCTCCTTGAGGG + Intronic
1201745081 Y:17363251-17363273 GACCCAAGCGGGCAACTTGAAGG + Intergenic
1201938323 Y:19431682-19431704 GACCAAAGTGGCCACCTTCAGGG + Intergenic