ID: 1062040816

View in Genome Browser
Species Human (GRCh38)
Location 9:134403518-134403540
Sequence GGCCCCAGGATGCCCCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062040812_1062040816 -8 Left 1062040812 9:134403503-134403525 CCTGCTGGGTCCCAGGGCCCCAG 0: 1
1: 0
2: 12
3: 74
4: 653
Right 1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 229
1062040804_1062040816 18 Left 1062040804 9:134403477-134403499 CCTGTCCCTTGGCTGACTGGCTG 0: 1
1: 0
2: 2
3: 24
4: 223
Right 1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 229
1062040807_1062040816 12 Left 1062040807 9:134403483-134403505 CCTTGGCTGACTGGCTGGCACCT 0: 1
1: 0
2: 2
3: 22
4: 304
Right 1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 229
1062040802_1062040816 21 Left 1062040802 9:134403474-134403496 CCGCCTGTCCCTTGGCTGACTGG 0: 1
1: 0
2: 0
3: 14
4: 249
Right 1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 229
1062040806_1062040816 13 Left 1062040806 9:134403482-134403504 CCCTTGGCTGACTGGCTGGCACC 0: 1
1: 1
2: 3
3: 12
4: 158
Right 1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062040816 Original CRISPR GGCCCCAGGATGCCCCTTGC TGG Intronic
900383181 1:2395476-2395498 GGCCCCAGGAGCAGCCTTGCTGG - Intronic
900458031 1:2786791-2786813 GGCCCAATGCTGCCCCCTGCTGG + Intronic
900593308 1:3469234-3469256 CGTCCCTGGATGCCCCTGGCTGG - Intronic
900626228 1:3609938-3609960 TGCCCCTGGAAGCCCCTGGCTGG + Intronic
900868747 1:5287013-5287035 GTCCCCAAGATTCCCCCTGCTGG - Intergenic
901051642 1:6428522-6428544 GGCCCCAGGATGGCCACTGGAGG - Intronic
902162088 1:14538900-14538922 GGGTCCTGGGTGCCCCTTGCTGG + Intergenic
902671529 1:17977797-17977819 GGCCCCAGGAGGCCACCTTCAGG + Intergenic
902957577 1:19936266-19936288 AGCCCCAGGAAGCCACTGGCTGG - Intergenic
902993392 1:20205321-20205343 AGCCACAGGAAGGCCCTTGCTGG + Intergenic
903862011 1:26370338-26370360 AGCCCCCGGATGCCCCTGACTGG + Intronic
904368399 1:30033311-30033333 TGCCCTTTGATGCCCCTTGCTGG + Intergenic
905110253 1:35589647-35589669 GTCCCCAGGATGCCCCACCCTGG + Intronic
905632692 1:39527465-39527487 GGCCCAAGGATGCGCCTCTCTGG + Intergenic
905665124 1:39758952-39758974 GGCCCAAGGATGCGCCTCTCTGG - Exonic
906841737 1:49146727-49146749 GGCCCCATCATGCTCCTTGGAGG - Intronic
915279777 1:154814493-154814515 GACCCCAGGGTGCCCCTTCTAGG - Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
919922922 1:202177095-202177117 GGACCCAGGATGCCCAGAGCTGG - Intergenic
920256911 1:204661712-204661734 GGCTCCCGGATGCCCTTGGCAGG + Intronic
920518004 1:206600787-206600809 GACCCCAGGATGCGGCTTGCTGG - Intronic
922535817 1:226379894-226379916 GGCCCCAAGCTGCCCCCTCCAGG - Intronic
922596204 1:226815284-226815306 GGCCCCAGGGTGTCCTGTGCTGG - Intergenic
1062957873 10:1552172-1552194 GCCCCCAGGATGCCCATGGGGGG + Intronic
1064933783 10:20657131-20657153 GGCCCCAGGATGCTACTAGAGGG - Intergenic
1067720257 10:48722792-48722814 GACCCCAGGAAGCTCCTGGCAGG + Intronic
1067799779 10:49351049-49351071 GGCCTCAGCTTGCCCCATGCAGG - Intergenic
1068005559 10:51389521-51389543 TGCCCCAGGATGCCCCCTAGTGG - Intronic
1069916214 10:71788918-71788940 TGCCCCATTCTGCCCCTTGCAGG + Intronic
1070157936 10:73847838-73847860 GGGCCCTGGATGCCCATTCCTGG + Intronic
1070745550 10:78931525-78931547 GACCCCAGGACTCCCTTTGCAGG - Intergenic
1071814157 10:89214870-89214892 GGGGCCTGGATGCCCCTTGGAGG - Exonic
1073179448 10:101574984-101575006 GGCCCGAGGTTGCCCCTGGAGGG - Intronic
1075489742 10:122856492-122856514 TCCCCCAGGCTGCCCCTTGAAGG - Intronic
1075838207 10:125474520-125474542 GGCCTCAGTGTCCCCCTTGCTGG + Intergenic
1076358455 10:129869455-129869477 GGCCCCAAGATGTCCTTTGGAGG - Intronic
1076692329 10:132230264-132230286 AGCCCCTGGCTGCCCCTGGCAGG + Intronic
1077530685 11:3093415-3093437 GGCCCCAGGATGTCCCTGGCAGG - Intronic
1079100555 11:17538947-17538969 GGCCCCAGGGTGCAGCTTGTTGG + Intronic
1079452481 11:20609397-20609419 GGCGCCAGGCTATCCCTTGCAGG + Intronic
1079452807 11:20611869-20611891 GGGCCCAGGCTGTCCCTTGCAGG + Intronic
1080779856 11:35419769-35419791 GGCCCCAGGTCACCCCGTGCGGG + Intronic
1081535560 11:43993620-43993642 GCCTCCTGGACGCCCCTTGCCGG + Intergenic
1081667948 11:44927398-44927420 GGCCCCAGAGTGCCCCTTCCTGG - Intronic
1083310834 11:61782893-61782915 GGCCCCAGCTTCCCCCTTCCTGG + Intronic
1083477409 11:62923189-62923211 GGACTCGGGATGCCCCCTGCTGG + Intergenic
1083945905 11:65922454-65922476 GGCTCCAGGAGGCCCCATGTGGG - Intergenic
1084500045 11:69530091-69530113 GCACCCAGGATGCCCCAGGCTGG + Intergenic
1085163184 11:74368073-74368095 GGCCACAGGATTCCACTTGATGG - Intronic
1086913984 11:92506290-92506312 GGCCCCAAGATCCTCCTTTCTGG + Intronic
1089703416 11:120259574-120259596 GGACCCAGGAGGCCCCATGAGGG - Intronic
1090732450 11:129583433-129583455 GGCTCCTGGACGCCCCTTGCTGG - Intergenic
1091586399 12:1819407-1819429 GGACTCAGGATGCCCCTAGAAGG - Intronic
1091807796 12:3368032-3368054 GCCCCCAGTAGACCCCTTGCAGG + Intergenic
1091917481 12:4280391-4280413 GGGCACAGGTTTCCCCTTGCTGG + Intronic
1093149632 12:15605683-15605705 GGTCCCATGAAGGCCCTTGCGGG - Intergenic
1094361925 12:29640030-29640052 GGCCCCGGAATGCCCCATGGGGG - Intronic
1096522312 12:52191374-52191396 GACCCCAGGATGGCCTTTGAGGG - Intronic
1098383587 12:69895531-69895553 GGCCCCAGGAGGGCACTTCCTGG - Intronic
1099033723 12:77560078-77560100 GGGCCCAGGCTGCCAGTTGCAGG + Intergenic
1099609808 12:84853487-84853509 GGGCCCAGGTTTCTCCTTGCTGG + Intergenic
1101727788 12:107402556-107402578 AGCCCCAGGAAGCCATTTGCAGG - Intronic
1103947043 12:124532479-124532501 GCTCCCAGGAGCCCCCTTGCAGG - Intronic
1103958494 12:124593055-124593077 GGCCCCAGGAAGCCCCTCAGAGG + Intergenic
1104694610 12:130853681-130853703 GGTCCCAGGTTGCCCCTAGATGG - Intergenic
1104985365 12:132593609-132593631 GGCCTCAAGATGCCCCTTCAGGG + Intergenic
1106208662 13:27621500-27621522 TGACCCAGGATGGCCCTTCCTGG - Exonic
1112803074 13:103133496-103133518 GGCCCCAGCTTCCCCCTTGGTGG + Intergenic
1114269037 14:21090435-21090457 GGTCCCACGCTGCCCCCTGCTGG + Exonic
1118441413 14:65815311-65815333 GGCTCCAGGATGCCACCTTCAGG - Intergenic
1118894072 14:69931296-69931318 GGACTCAGGCTGCCCCTTGAAGG - Intronic
1119805964 14:77482572-77482594 CGCCCCAGGATACCCTTAGCTGG - Exonic
1120788244 14:88556108-88556130 CGACCCAAGATGCACCTTGCTGG - Intergenic
1120847682 14:89140247-89140269 GGCTCCAGGATGCCCACTGGAGG + Intronic
1121102586 14:91260236-91260258 GGCTCCAGGGTGCACCTTCCTGG - Intergenic
1121643419 14:95501459-95501481 GGCACCTGGATGCCCCATGGAGG - Intergenic
1121820504 14:96962048-96962070 TGCCATAGGATGACCCTTGCTGG + Intergenic
1122628991 14:103098936-103098958 GGGCCCAGCAGGCACCTTGCTGG + Intergenic
1129152386 15:73697121-73697143 GGCCTCAGGGTGGCCCTTGTGGG + Intronic
1129679539 15:77650470-77650492 GGGTCCAGGCTGCCCCCTGCTGG - Intronic
1130650252 15:85758417-85758439 AGTCCCAGGATGCCCCTCCCAGG + Intergenic
1131067320 15:89442655-89442677 GGCCTCATGAGGCCCTTTGCAGG + Intergenic
1131401367 15:92128158-92128180 GGCCCTGGGCTGCTCCTTGCTGG + Intronic
1131716171 15:95113040-95113062 GGCCCCAGGATACCTCATGTGGG - Intergenic
1132514049 16:358083-358105 TGGCCCAGGAAGCCCCTGGCAGG - Intergenic
1132648045 16:1008041-1008063 GGACCCAGGAAGCCCCTTCAAGG + Intergenic
1132766613 16:1537530-1537552 GGCCACAGGACACCCCTGGCAGG - Intronic
1133275971 16:4638641-4638663 GGTCCCAGGATGCCCCCACCAGG - Intronic
1135208648 16:20504372-20504394 GTCCCCAGGAAGGCTCTTGCTGG - Intergenic
1135230999 16:20707417-20707439 GTCCCCAGGAGGGCTCTTGCTGG - Intronic
1137411485 16:48232032-48232054 GGCCCCAATATGCTCCCTGCAGG - Exonic
1138581637 16:57945391-57945413 GACCCCAGGAAGCCTCTGGCTGG - Intronic
1139559136 16:67730520-67730542 GGCTGCAGCATGCCCCCTGCTGG + Intronic
1139949212 16:70661019-70661041 GCCCCCAGGCAGCCCCTAGCAGG + Intergenic
1140041683 16:71412455-71412477 GGCGCCAGAGTGCCCCCTGCTGG + Intergenic
1141395030 16:83696930-83696952 TGGCCCAGGAAGCCCCTGGCTGG + Intronic
1141781392 16:86163998-86164020 GGGCCCAGGAGACCCCTTCCAGG - Intergenic
1141828234 16:86495639-86495661 GCCCCCAGGCTGACCCTTGATGG + Intergenic
1142214466 16:88823874-88823896 ATGCCCAGGATGGCCCTTGCAGG + Intronic
1142418779 16:89957678-89957700 GGCCCCAGGCTGCCCCACGGCGG - Intronic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1143179187 17:4973655-4973677 GGCCCATGGAAGCCCCTTCCGGG - Exonic
1143411794 17:6713577-6713599 GGGCCCAGGCTGCCCCTAGAGGG - Intergenic
1143600740 17:7944255-7944277 GTCCCCAGAGTGCCCCTTTCAGG + Intronic
1144452110 17:15389798-15389820 GGCCCCAGGGTTTTCCTTGCTGG + Intergenic
1146459441 17:33033782-33033804 GGACTCAGGGTGCCCCTTCCAGG + Intronic
1147139641 17:38453915-38453937 GGCCCCAGTACGCCCCAGGCCGG - Intronic
1147150669 17:38511750-38511772 GGGTCCAGGGTCCCCCTTGCTGG + Exonic
1147165674 17:38591943-38591965 AGGCCCAGGATGCCCCTGTCTGG + Intronic
1148457648 17:47819667-47819689 GGCCCCAGTATGCCCTGGGCAGG - Intronic
1148587437 17:48790956-48790978 GGCCCCAGGACGCTCTCTGCTGG + Intronic
1149485093 17:57036459-57036481 TGGCCAAGGAAGCCCCTTGCAGG + Intergenic
1149531344 17:57397713-57397735 TCCCCCAGCATGCCCCTGGCGGG + Intronic
1151478094 17:74355021-74355043 CGCCTCTGGCTGCCCCTTGCTGG + Intronic
1151540981 17:74764401-74764423 GGCCCCTGGAAGTCCCTAGCTGG + Intronic
1151947062 17:77325555-77325577 GGCCTCAGGACGCCCCGGGCTGG - Intronic
1152478627 17:80535217-80535239 GGCCCCCGGCAGCCACTTGCAGG + Intergenic
1152503003 17:80725642-80725664 GGCTGCAGGCTGCCCTTTGCTGG + Intronic
1152582102 17:81170750-81170772 GCCCCAAGGATGCCCCTGCCTGG + Intergenic
1152658468 17:81530770-81530792 GGCCCGAGGATGCCAACTGCAGG - Intronic
1152907525 17:82977009-82977031 GGCCCCAGGTGGCCCCAGGCAGG + Intronic
1154017994 18:10637448-10637470 GGCCACCGAATGCCCCTTGCTGG - Intergenic
1154060605 18:11056205-11056227 GGGTCCAGGCTGCCCCTGGCCGG + Intronic
1154169122 18:12038220-12038242 AGCCCCAGGGTGCCCCTAGCAGG - Intergenic
1154186876 18:12192134-12192156 GGCCACCGAATGCCCCTTGCTGG + Intergenic
1160879693 19:1313739-1313761 GGCCCCAGGATCCCCTTGTCTGG + Intergenic
1160989608 19:1855191-1855213 GGCCCCTGCATGCCCCTGGGTGG - Intronic
1161065068 19:2233451-2233473 GGCCCCAGGATCCACCTAACTGG - Exonic
1161937843 19:7383021-7383043 GGTCTCAGGATGCCCTCTGCAGG - Intronic
1162362273 19:10227349-10227371 GGGGCCAGGATGCCCCTTGGAGG - Intronic
1163171290 19:15532949-15532971 GGCCCCAGGGTGCCCCCACCTGG + Intronic
1163233848 19:16020110-16020132 GGCCCCACGAGGGCCCTTGGGGG + Intergenic
1164633030 19:29774077-29774099 GGCTCCAGCCTGGCCCTTGCAGG + Intergenic
1165922034 19:39305281-39305303 GGCCTCAGGGGGCCCCTGGCTGG + Intergenic
926424588 2:12729261-12729283 GTCCCCAGGAAGCCCCCAGCAGG - Intronic
926688820 2:15718627-15718649 GGCCACAGGATGGGCCTAGCAGG - Intronic
926758287 2:16253319-16253341 AGGCCCATGATGCCCCTTCCAGG + Intergenic
930705555 2:54501721-54501743 GGTACCTGGATGCCCTTTGCTGG + Intronic
932167573 2:69522332-69522354 GGGCCCAGGATGGACCTTGGAGG - Intronic
933242365 2:79936475-79936497 GGCCAGAGGATGCCGGTTGCAGG - Intronic
934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG + Intergenic
934653322 2:96104438-96104460 GGCCCCAGGCTGCCCCCTCAGGG - Intergenic
935084591 2:99832516-99832538 GGCACCAGGGTGCCCTTAGCAGG + Intronic
936086374 2:109472299-109472321 GGGCCCGGGAGGCCCCTGGCCGG - Intronic
936428180 2:112436703-112436725 GGCCACAGGCTGACCCGTGCAGG + Intergenic
938338830 2:130522465-130522487 GTCCCCAGGAGGCCCCTCGCCGG + Intronic
938343781 2:130552181-130552203 GCCCCCAGAATTCCACTTGCGGG - Intergenic
938346052 2:130568541-130568563 GCCCCCAGAATTCCACTTGCGGG + Intergenic
938351008 2:130598285-130598307 GTCCCCAGGAGGCCCCTCGCCGG - Intronic
938981990 2:136535792-136535814 TGACCCAGGATGCCCCTAGGAGG - Intergenic
948142049 2:235680681-235680703 CGCGCCAGGATGCTCCTGGCAGG - Intronic
948874977 2:240821218-240821240 GACGCCAGGATGCCCATGGCAGG - Intergenic
1170503896 20:17004015-17004037 GTCCCCAGCATGTCCCTTGAAGG - Intergenic
1172120100 20:32593339-32593361 AGCCCCAGCATGCCCACTGCTGG - Intronic
1173519975 20:43692135-43692157 GGCCCCCTGCTGCCCCCTGCAGG + Exonic
1175265943 20:57703566-57703588 GACCCCAGCATGCCCGTTGCTGG - Intronic
1175266766 20:57708226-57708248 GGGGCCAGGCTGCCCCTAGCTGG - Intronic
1175825218 20:61933306-61933328 GGTCCCAGGATCCCCCGTGGGGG - Intronic
1176374071 21:6078508-6078530 GGCCACAGGCTGACCCGTGCAGG - Intergenic
1179281665 21:39939117-39939139 GGCCCTGAGACGCCCCTTGCTGG + Intergenic
1179485001 21:41704406-41704428 GGCCCCAGAATAGCCCCTGCAGG + Intergenic
1179749406 21:43459735-43459757 GGCCACAGGCTGACCCGTGCAGG + Intergenic
1182351485 22:29702475-29702497 GGCCCAAGGAGGGCCCCTGCTGG - Intergenic
1182401033 22:30078206-30078228 CGCCCCAGGATGCCCAGTGCTGG - Intergenic
1183706646 22:39478547-39478569 GTCCCCAGGGTGCCCTTGGCTGG - Intronic
1184286730 22:43476238-43476260 GGCCACAGGGTGCCCAGTGCTGG + Intronic
950185167 3:10940241-10940263 GGCCCCAGCCTGGCCCTTCCTGG - Exonic
950490818 3:13303908-13303930 AGCCTCAGGATGCCACTTCCAGG + Intergenic
951749099 3:26013966-26013988 GGCCCTAGGATACCCATGGCAGG - Intergenic
967877194 3:194275588-194275610 GGTCCCTGGACTCCCCTTGCTGG - Intergenic
968917968 4:3505494-3505516 GGCCGCAGGAGGCCCCTGCCAGG - Intergenic
968947955 4:3675460-3675482 AGCCCCAGGCTGCCTCCTGCAGG + Intergenic
969319664 4:6404112-6404134 GTCCCCAGGAGTCCCCTTCCTGG - Intronic
969435324 4:7186028-7186050 GGCCTGCTGATGCCCCTTGCTGG + Intergenic
975991740 4:80265726-80265748 CGCCCCAGGATCCCCGTGGCAGG - Intergenic
976450737 4:85187875-85187897 GGTCCCAGGCTTCCCATTGCTGG + Intergenic
976615744 4:87074365-87074387 GGCCCCATGAAGCCCATTGTGGG - Intronic
979344179 4:119566812-119566834 GGCCCCAACATGCCCAGTGCAGG + Intronic
985276991 4:188246699-188246721 GGCACAAGTATGCCCCTCGCTGG + Intergenic
985343558 4:188976909-188976931 GGCCTTAGGAGGCCTCTTGCTGG - Intergenic
985565857 5:616886-616908 GGCACCAGGAGGGGCCTTGCAGG - Intronic
985578235 5:683588-683610 GACTGCAGGATGCCCCTGGCAGG + Intronic
985593162 5:775728-775750 GACTGCAGGATGCCCCTGGCAGG + Intergenic
985671447 5:1208952-1208974 GGGCCCAGGGTTCGCCTTGCCGG + Intronic
985816527 5:2132026-2132048 GGCCCCTGAATGCCACTTACAGG + Intergenic
985840022 5:2299040-2299062 GCCCTCAGGATGGCCCTTTCTGG - Intergenic
989188472 5:38646924-38646946 GGCCCCAGGCTGCCCCAGGCAGG + Intergenic
989405997 5:41061540-41061562 GGCCTCAGGATGCCTCAAGCTGG - Intronic
989716405 5:44468347-44468369 GGCCCCAAGAGGCACCTTGTTGG + Intergenic
990410576 5:55537165-55537187 GGCCTCAGGATTCCCCTTGTGGG - Intergenic
998182341 5:139954265-139954287 GGCCCCAGGCTGCTCCTCTCTGG - Intronic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1001877715 5:175215803-175215825 TCCCCCAGGGTGCCCCTTGGAGG + Intergenic
1002316962 5:178349756-178349778 GGCCCCAGGCTCCTCCTTGCAGG + Intronic
1003279463 6:4679123-4679145 GGCCCCAGGAGGCCCCACCCTGG + Intergenic
1004031176 6:11870898-11870920 GGCCCCAGGATATGCCTTCCTGG + Intergenic
1004323463 6:14651967-14651989 GGCCCCAGGCTGGTCCTTTCTGG - Intergenic
1004748053 6:18532325-18532347 GGCCCAAGGATGCGCATTTCTGG + Intergenic
1006301373 6:33195121-33195143 AGCCACAGGATGCCCCTTTTGGG + Intronic
1006390466 6:33755240-33755262 GGCCGGAGGAGGCCACTTGCAGG + Intergenic
1006393336 6:33771673-33771695 GGCTGCAGGCTGCCCCCTGCCGG - Exonic
1007112758 6:39322527-39322549 GGCCACAGCATGCCCAGTGCTGG - Exonic
1007165221 6:39824297-39824319 GACCCCAAGATGCCCCCTGCTGG - Intronic
1007280984 6:40712303-40712325 GGCCCAGGGCTGCCCCATGCTGG + Intergenic
1007934773 6:45723170-45723192 GGCTCAAGGATGCTCCTGGCAGG + Intergenic
1011117054 6:83905640-83905662 GGCCCCAGGATGGCATATGCTGG + Intronic
1012861876 6:104570106-104570128 AGCCATAGGATGACCCTTGCCGG - Intergenic
1017761603 6:157573818-157573840 AGCCCCAGGATGTCCCTGCCAGG + Intronic
1019281150 7:200913-200935 AGCCCCAGGGTGCCCACTGCTGG + Intronic
1019406456 7:886690-886712 GGCCCCAGTACGCCCCTCCCCGG + Intronic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1019645314 7:2125748-2125770 GACCCCAGGAAGCCCTTAGCTGG - Intronic
1019701698 7:2477446-2477468 GCCCCCAGGATGCCCCCGCCAGG + Intergenic
1020118232 7:5488219-5488241 GGCTCCATGCCGCCCCTTGCAGG - Intronic
1022533970 7:31084437-31084459 AGGTCCAGGAAGCCCCTTGCTGG - Intronic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1025099576 7:56123601-56123623 GTCCCCAGAATGCCCTTGGCAGG - Intergenic
1026509764 7:71018310-71018332 GGCCCAGGGATGCCTTTTGCTGG - Intergenic
1026534577 7:71229303-71229325 GGACCCAGGATTCCCCTGGGAGG + Intronic
1029423471 7:100483568-100483590 GGCCCCAGGCTGCCGCTGGGGGG + Intergenic
1029543428 7:101198092-101198114 GGCACCCGGATCCCCCATGCAGG + Intronic
1029705223 7:102272535-102272557 GGCCACTGGATCCCCCTTTCTGG - Intronic
1032436835 7:131907649-131907671 TGCCATAGGATGCCCCTTTCTGG - Intergenic
1034445470 7:151111749-151111771 TGCCCCAGGATGCACACTGCGGG + Intronic
1035248553 7:157581339-157581361 GGCCTCAGCATCCCCCTTGAAGG + Intronic
1035352412 7:158255973-158255995 TGCCACAGGAAACCCCTTGCTGG + Intronic
1035621164 8:1036570-1036592 GGCCCCATGAGGCCCATTCCAGG - Intergenic
1037952769 8:23029499-23029521 GCCTCAAGGATGCCCCTTGCGGG + Intronic
1038151130 8:24942802-24942824 GACCCCAGGATGCCCCCCGGGGG - Intergenic
1043035825 8:75197471-75197493 GGCCCCTGGGTGGCCCTTGCTGG - Intergenic
1046058417 8:109106851-109106873 AGCCTCATGTTGCCCCTTGCAGG + Intronic
1048282658 8:133116511-133116533 GGGCCCAGGGGGCCCCTTGCTGG + Intronic
1049721306 8:144116695-144116717 GGTCCCAGGATGAGCCTTCCGGG + Exonic
1051352972 9:16215609-16215631 GGCCCCAGGAGACAACTTGCTGG + Intronic
1053138104 9:35664455-35664477 GGCCCCAGCATCCTCCTTCCAGG + Exonic
1056965734 9:91161668-91161690 GGTCCCAGGTGGCCCCTGGCCGG + Intergenic
1057147130 9:92765502-92765524 GGCCCCTGGGCGCCCCCTGCTGG - Intergenic
1057291504 9:93810141-93810163 CGCCTCAGGCTGCCCCTAGCAGG - Intergenic
1059767517 9:117397588-117397610 GGCCCAAGGCTGCCTCTTGGAGG - Intronic
1059910860 9:119042602-119042624 CGCCCCAGGAATCCCCTTCCTGG - Intergenic
1060794493 9:126504796-126504818 GACCCGAGGATGCCCCTGGTGGG + Exonic
1061132896 9:128718240-128718262 GGCACCAGGATGGCCATAGCGGG - Intronic
1061136194 9:128735358-128735380 GGGCCCAGGTTGCCCAGTGCTGG + Exonic
1061291900 9:129655158-129655180 GCTCCCAGGATGACCCTTGCTGG - Intergenic
1061678542 9:132231476-132231498 GGACCCAGGGGGCCCCTGGCTGG + Intronic
1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG + Intronic
1062086003 9:134648854-134648876 TGCCCAAGGATGCACCTTCCTGG - Intronic
1186352150 X:8750932-8750954 GACCCCAGGAGGCCCCTGGGTGG + Intergenic
1188615539 X:32154786-32154808 GGCGCCAAGATTCCCCTAGCAGG + Intronic
1192417449 X:70994947-70994969 GGCCCCAGGATTATCTTTGCTGG + Intergenic
1195303973 X:103560811-103560833 GGGCACAGGATGCCCCTTTTTGG + Intergenic
1200153309 X:153962106-153962128 GGCCTGAGGATGCCTCTTTCTGG - Intronic