ID: 1062042266

View in Genome Browser
Species Human (GRCh38)
Location 9:134409553-134409575
Sequence CTTATTAACAAATCTGTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062042263_1062042266 2 Left 1062042263 9:134409528-134409550 CCTTTCCTTTTGTTTTTGTGCTC 0: 1
1: 0
2: 6
3: 81
4: 1004
Right 1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG No data
1062042264_1062042266 -3 Left 1062042264 9:134409533-134409555 CCTTTTGTTTTTGTGCTCGTCTT 0: 1
1: 0
2: 1
3: 33
4: 644
Right 1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG No data
1062042259_1062042266 26 Left 1062042259 9:134409504-134409526 CCCCAGGCTCTTGGAGCAGTTCC 0: 1
1: 0
2: 1
3: 23
4: 177
Right 1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG No data
1062042261_1062042266 24 Left 1062042261 9:134409506-134409528 CCAGGCTCTTGGAGCAGTTCCTC 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG No data
1062042258_1062042266 27 Left 1062042258 9:134409503-134409525 CCCCCAGGCTCTTGGAGCAGTTC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG No data
1062042260_1062042266 25 Left 1062042260 9:134409505-134409527 CCCAGGCTCTTGGAGCAGTTCCT 0: 1
1: 0
2: 0
3: 16
4: 209
Right 1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG No data
1062042262_1062042266 5 Left 1062042262 9:134409525-134409547 CCTCCTTTCCTTTTGTTTTTGTG 0: 1
1: 0
2: 7
3: 183
4: 2281
Right 1062042266 9:134409553-134409575 CTTATTAACAAATCTGTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062042266 Original CRISPR CTTATTAACAAATCTGTGTC GGG Intronic
No off target data available for this crispr