ID: 1062043173

View in Genome Browser
Species Human (GRCh38)
Location 9:134413492-134413514
Sequence GACCCAGAGAGCAGCGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043173_1062043183 20 Left 1062043173 9:134413492-134413514 CCTCTGGCGCTGCTCTCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1062043183 9:134413535-134413557 AGGAGGCCAGAATGGTTTGGTGG No data
1062043173_1062043174 0 Left 1062043173 9:134413492-134413514 CCTCTGGCGCTGCTCTCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1062043174 9:134413515-134413537 TCTGTCTCCCCACCCTTAAGAGG No data
1062043173_1062043180 12 Left 1062043173 9:134413492-134413514 CCTCTGGCGCTGCTCTCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1062043180 9:134413527-134413549 CCCTTAAGAGGAGGCCAGAATGG No data
1062043173_1062043182 17 Left 1062043173 9:134413492-134413514 CCTCTGGCGCTGCTCTCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1062043182 9:134413532-134413554 AAGAGGAGGCCAGAATGGTTTGG No data
1062043173_1062043185 27 Left 1062043173 9:134413492-134413514 CCTCTGGCGCTGCTCTCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043173_1062043175 3 Left 1062043173 9:134413492-134413514 CCTCTGGCGCTGCTCTCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1062043175 9:134413518-134413540 GTCTCCCCACCCTTAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043173 Original CRISPR GACCCAGAGAGCAGCGCCAG AGG (reversed) Intronic
900237451 1:1599546-1599568 GGCCCAGCGCGCAGCGGCAGCGG + Exonic
900382505 1:2391863-2391885 GAGCCGGAGCGCAGCGCCTGCGG + Exonic
900439242 1:2645125-2645147 CACACAGGGAGCAGGGCCAGAGG + Intronic
900471605 1:2857700-2857722 TGCCCAGCGAGCAGCCCCAGTGG - Intergenic
903333771 1:22611685-22611707 GACCCAGAGGTAAGAGCCAGCGG - Intergenic
904940620 1:34163339-34163361 CACCCAGAGAGGGGCGCCCGCGG - Intronic
904984250 1:34531820-34531842 GACCCAAAGAGCCTGGCCAGAGG - Intergenic
908565865 1:65355498-65355520 GACCAAGAGAGCAGAAGCAGGGG - Intronic
909316351 1:74224065-74224087 GACCCAGTGTGAAGCCCCAGTGG + Intronic
910266764 1:85346159-85346181 TACTCAGAGAGCAGTGACAGAGG + Intronic
910796153 1:91099672-91099694 GATCCATAGAGCAGCCCCATGGG + Intergenic
911875699 1:103160457-103160479 CACCCAGAGAGTAGCAACAGTGG + Intergenic
912524372 1:110270210-110270232 GACCCAGAGAGGAGAGTCTGAGG - Intronic
913696719 1:121333431-121333453 CACCCAGAGAGCAGCCTCAAGGG - Intronic
914140841 1:144946629-144946651 CACCCAGAGAGCAGCCTCAAGGG + Intronic
915105821 1:153534648-153534670 GACTCAGAGAGGACCCCCAGAGG + Exonic
919820808 1:201470774-201470796 GGCCCAGAGAGCAGCAGAAGAGG + Intergenic
919973923 1:202598816-202598838 GACCTAGAGAGCAGTGGAAGTGG + Intronic
920484050 1:206351785-206351807 CACCCAGAGAGCAGCCTCAAGGG - Intronic
921216524 1:212942359-212942381 GAACCAGAGAGCAGAGTGAGGGG + Intergenic
921953211 1:220955424-220955446 GACCGAGAGAGAACCTCCAGTGG + Intergenic
922696146 1:227731987-227732009 AACCCACAGGGCAGAGCCAGGGG + Exonic
922746551 1:228047533-228047555 GACCGAGACAGCAGCCCCTGGGG - Intronic
923476933 1:234342924-234342946 TTCACAGAGAGCAGAGCCAGGGG + Intergenic
923783006 1:237042437-237042459 GAAGCAGAAGGCAGCGCCAGGGG + Exonic
924116988 1:240757597-240757619 AACCCACAGAGCAGCTTCAGTGG + Intergenic
1063681696 10:8194328-8194350 CACCCACAGAGCAGTGCCAAGGG + Intergenic
1064923440 10:20543488-20543510 TTCCCAGAGGGCAGAGCCAGAGG - Intergenic
1069832399 10:71289349-71289371 GGCCCAGAGAGGAGGGCCAAGGG - Intronic
1069832886 10:71291755-71291777 GACCCAGGGAGCAGCGTCAGCGG + Exonic
1070155076 10:73828244-73828266 GACCCGGAGTCCAGCACCAGAGG + Intronic
1071561668 10:86650460-86650482 ACCCCAGAGATTAGCGCCAGTGG - Intergenic
1072530351 10:96312985-96313007 GTCCCTGAGAGCAGGGACAGTGG - Intronic
1073105946 10:101032151-101032173 AACCAAGGGAGCAGCGCCCGCGG + Intronic
1074188905 10:111118884-111118906 GGCCCAGAGACCAGCGGCACAGG + Intergenic
1074678517 10:115880222-115880244 GACCCAGAGATCTGAGACAGTGG + Intronic
1074744841 10:116522088-116522110 ACCCCAGAGAGCAGAGCCTGTGG - Intergenic
1075253630 10:120906329-120906351 GGCCCAGAGAGCAGGGGGAGAGG + Intronic
1075703855 10:124486822-124486844 GACTGAGAGAGCAGGGCCCGAGG + Intronic
1076601953 10:131663073-131663095 GACCCACAGAGCAGAGCCCAGGG + Intergenic
1076761179 10:132606415-132606437 GACCCAGAGGGCAGGGCATGGGG + Intronic
1076774675 10:132688144-132688166 GCCCCAGAGAGCTGACCCAGGGG + Intronic
1077210413 11:1368535-1368557 TACCCAGAGGGCAGCCACAGAGG - Intergenic
1077220605 11:1413817-1413839 GAGCCAAGGAGCAGCCCCAGGGG + Intronic
1077723000 11:4646181-4646203 GAGGCTGACAGCAGCGCCAGAGG + Intronic
1079320291 11:19446427-19446449 GACACAGAGAACAAGGCCAGAGG + Intronic
1080117020 11:28632649-28632671 GACCCAGAGGGCAGAGTCTGTGG + Intergenic
1080562620 11:33477913-33477935 GACCCAAGGAACAGCCCCAGAGG + Intergenic
1081873999 11:46396716-46396738 GGCCCTCAGAGCAGCGCCTGTGG - Exonic
1084166645 11:67377918-67377940 GACACAGAGAGGAGCCCTAGGGG + Intronic
1084356152 11:68640178-68640200 GACCCGGAGAACAGCGGAAGTGG + Intergenic
1088719666 11:112580875-112580897 GACCCAGAAGGCAGCACCAAAGG - Intergenic
1089293292 11:117451257-117451279 GGCCCAGAGAGGAGGGCAAGGGG - Intronic
1089400528 11:118161713-118161735 GACCCAGAGACCCTCACCAGTGG - Intergenic
1089556167 11:119316960-119316982 GTGCCAGGGAGCAGAGCCAGCGG - Intronic
1089572291 11:119418711-119418733 GACCAGGAAAGCAGCGCTAGTGG - Exonic
1092512919 12:9176620-9176642 AACCCACAGGGCAGGGCCAGAGG + Intronic
1093356386 12:18173198-18173220 GAACCAGAGACCACCCCCAGAGG - Intronic
1093653924 12:21674224-21674246 GAAACCGAGCGCAGCGCCAGTGG + Intronic
1095344444 12:41133114-41133136 GGCCCAGAGAACAGCACTAGAGG - Intergenic
1096509999 12:52122345-52122367 GACCCCGAGAGCAGCTGGAGTGG + Intergenic
1097184369 12:57188740-57188762 GACCCAGTGGGGAGCGCGAGGGG + Intronic
1097947664 12:65389713-65389735 GACCCAGAGAGCACTGGCAAAGG - Intronic
1102783966 12:115588765-115588787 GCCCCAGCGGGCAGCCCCAGTGG - Intergenic
1103981845 12:124741842-124741864 GACCCCGTGAGCAGGGGCAGGGG + Intergenic
1104038264 12:125113477-125113499 AACCCAGAGAGCAGAGCCAGTGG - Intronic
1104937833 12:132375980-132376002 GACCCAGAGCCCAGCGCCCCGGG + Intergenic
1108751519 13:53452565-53452587 GAAATCGAGAGCAGCGCCAGTGG + Intergenic
1111947808 13:94683681-94683703 GATCCAGAGAGCAGCCTCTGCGG + Intergenic
1113617663 13:111692674-111692696 GACCCAGAGGGCAATGCCTGGGG + Intergenic
1113623193 13:111777934-111777956 GACCCAGAGGGCAATGCCTGGGG + Intergenic
1114618157 14:24079462-24079484 GAGCCAGAGAGGATGGCCAGTGG + Intergenic
1115640334 14:35331738-35331760 GACCAAGAGAGCAGCACAGGCGG - Intergenic
1117951085 14:61083169-61083191 CAGCCAGAGAGCAGCACCAGTGG + Intronic
1119479027 14:74948349-74948371 GACCAAGAGGGCAGGACCAGGGG - Intronic
1119778956 14:77265683-77265705 GAGCCAGAAAGGAGGGCCAGGGG + Exonic
1121137312 14:91510318-91510340 CACCCAGGGAGCAGCTGCAGGGG + Intronic
1121253050 14:92513795-92513817 GCCCCAGAGCGCGGCGGCAGCGG + Exonic
1122882387 14:104695877-104695899 CACCCAGAGAGCAGAGCTGGGGG - Intronic
1123122743 14:105925611-105925633 GACCCAGGCAGCAGCCACAGAGG + Intronic
1123405386 15:20017032-20017054 GACCCAGGCAGCAGCCACAGAGG + Intergenic
1123514716 15:21023680-21023702 GACCCAGGCAGCAGCCACAGAGG + Intergenic
1124339345 15:28879899-28879921 GTTCCAGAGAGCAGAGCCAGAGG - Intergenic
1124350919 15:28954975-28954997 TATGCAGAGAGCAGGGCCAGAGG + Intronic
1129246110 15:74279979-74280001 GACCCCCAGAGCAGCCCCTGTGG + Exonic
1129683152 15:77669611-77669633 GACCCTGGGAGCAGTCCCAGAGG - Intronic
1130915941 15:88304583-88304605 GCCCCAGAGAGAAGCACAAGGGG + Intergenic
1132497453 16:270628-270650 GACCCAGTGGGCAGCTCCGGGGG + Exonic
1132663546 16:1071900-1071922 GACCCAGGGAGCCCCGCCACTGG - Intergenic
1133019433 16:2960713-2960735 GACCCTGAGAGCAGCCCTGGGGG - Intergenic
1133196332 16:4173423-4173445 CACCCAGACTGCAGTGCCAGTGG + Intergenic
1133235241 16:4384581-4384603 GACCCAGGGAGCAGGCCCCGTGG + Intronic
1134414271 16:14030135-14030157 GACCCAGAAAACTGAGCCAGAGG - Intergenic
1135118411 16:19743447-19743469 GAGCCAGAGAGTAGAGCAAGAGG + Intronic
1137011613 16:35327276-35327298 GAACCAGAGACCAGTGGCAGAGG - Intergenic
1139565453 16:67772769-67772791 GACACAGGGAGCAGCCCCACAGG - Intronic
1139565733 16:67774657-67774679 GACACAGGGAGCAGCCCCACAGG + Intronic
1140963542 16:79941580-79941602 GACTCAGAGTGAAGCGACAGTGG - Intergenic
1141139479 16:81487806-81487828 GTGCCAGAGAGCAGCTTCAGGGG + Intronic
1141299644 16:82802074-82802096 AACCCAGTGAGCTGCCCCAGTGG - Intronic
1142130142 16:88428540-88428562 GGCCGAGTGAGCAGCTCCAGGGG - Exonic
1142248213 16:88979362-88979384 TTCCCAGAGAGCAGGACCAGGGG - Intergenic
1142287374 16:89176940-89176962 GCCCCAGAGAGCATGGCCCGGGG + Intronic
1142759594 17:2034916-2034938 GCCCCAGAGAGCATCCCCAAGGG - Intronic
1143584721 17:7845391-7845413 GTCCCAGAGAGCTGGGGCAGGGG + Exonic
1150234781 17:63584183-63584205 GACCCAGAGCGCCCGGCCAGAGG - Intronic
1150796172 17:68239088-68239110 GACCCAGAGCTCAGCTTCAGTGG - Intergenic
1150835996 17:68564847-68564869 GACCCTGAGGGCAGAGCCACTGG + Intronic
1151943089 17:77304998-77305020 GGCCCAGAGTGCAGCTCCGGTGG - Intronic
1152026455 17:77812580-77812602 GGCCCAGAGAGCAGCCACTGGGG + Intergenic
1152253074 17:79221758-79221780 GAGCCAGGGAGCAGAGCCAGAGG - Intronic
1152398070 17:80047283-80047305 GATCCACAGAGGAGCCCCAGGGG + Exonic
1152869332 17:82743571-82743593 GACCCAGCTGGCAGCCCCAGGGG - Intronic
1153556941 18:6324425-6324447 GGCCCTGAGAGCAGCCACAGGGG + Intronic
1156943181 18:42795421-42795443 GAAATCGAGAGCAGCGCCAGTGG - Intronic
1157273747 18:46295399-46295421 AACTCAGAGGGCAGCACCAGAGG - Intergenic
1159313558 18:66740425-66740447 GACCCAGAGAGAAGCCCTAGAGG - Intergenic
1160006301 18:75071582-75071604 AAGCCAGAGAGGAGCACCAGAGG + Intergenic
1160210588 18:76874829-76874851 GAGCAAGAGAGCAGGGGCAGGGG + Intronic
1160701708 19:510698-510720 GCCCCAGAGTGCAGCCCCGGAGG + Intronic
1160735960 19:662586-662608 GACCCCGAGAATAACGCCAGGGG - Intronic
1160985776 19:1837855-1837877 GCCCCAGAGAGCAGAGCTGGTGG - Intronic
1161960865 19:7522499-7522521 GACCCAGAGGGCGCCGGCAGAGG + Intergenic
1162109686 19:8393400-8393422 GACCCAGAGGACAGGGCCTGGGG - Intronic
1162268674 19:9596476-9596498 GAACCAGAGACCACCCCCAGAGG + Intergenic
1162336679 19:10065594-10065616 GACCTAGAGATCAAAGCCAGTGG + Intergenic
1162800510 19:13107766-13107788 GTCCCAGAGGGCAGAGGCAGGGG + Exonic
1164213136 19:23117462-23117484 GAACCAGAGAGGATCGTCAGAGG + Intronic
1164789315 19:30962330-30962352 GACACATATAGCAGGGCCAGTGG - Intergenic
1164904555 19:31956470-31956492 GACCCAAAGACCAGCTGCAGGGG + Intergenic
1166679800 19:44759362-44759384 GACCCAGAGAGCAGGGGCTGGGG - Intronic
1167268901 19:48497509-48497531 GCCCCAGACAGCAGGGCCGGCGG - Exonic
925169174 2:1740513-1740535 GACCCACAGAGCAGCAACACTGG + Intronic
925289190 2:2735540-2735562 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289244 2:2735937-2735959 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289255 2:2736007-2736029 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289266 2:2736079-2736101 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289271 2:2736114-2736136 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289300 2:2736293-2736315 GACTCAGAGAGCAGAGCCCGGGG + Intergenic
925289306 2:2736328-2736350 GACTCAGAGAGCAGAGCTCGGGG + Intergenic
925289316 2:2736398-2736420 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289326 2:2736470-2736492 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289331 2:2736505-2736527 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289341 2:2736577-2736599 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289346 2:2736612-2736634 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289356 2:2736684-2736706 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289361 2:2736719-2736741 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289370 2:2736791-2736813 GACTCAGAGAGCAGAGCCCAGGG + Intergenic
925289376 2:2736826-2736848 GACTCAGAGAGCAGAGCCCGGGG + Intergenic
925289382 2:2736861-2736883 GACTCAGAGAGCAGAGCCCGGGG + Intergenic
934515058 2:94981234-94981256 GCCCCAGAGTGCAGCCTCAGTGG + Intergenic
936525923 2:113241675-113241697 GACTCACAGAGCAGCAGCAGCGG - Exonic
937451933 2:122009449-122009471 GACCCAGAGAGCTGGCACAGAGG + Intergenic
939281765 2:140073978-140074000 GGCCCGGAGCGCAGCGCCGGTGG - Intergenic
941261855 2:163307258-163307280 GCCCATGAGAGCAGCTCCAGGGG + Intergenic
942399192 2:175583286-175583308 GGCCCAGAGTGCAGCCCCATGGG - Intergenic
942448093 2:176091869-176091891 GACCCTGAGAACGGCGCCGGGGG - Intergenic
944446879 2:199801117-199801139 GACTCACAAAGCAGGGCCAGAGG - Intronic
944729649 2:202503559-202503581 GAAACTGAGAGCAGCGCCGGTGG - Intronic
946302659 2:218833355-218833377 TTCCCAGAGAGCAGAACCAGGGG + Intergenic
946427192 2:219605675-219605697 GACCCCCAGAGCAGCCCCTGAGG - Exonic
947618352 2:231573339-231573361 GACGCAGAGAGCAGGGACAGTGG - Intergenic
948524992 2:238566105-238566127 GACCCAGAGAGATGGGCCTGAGG - Intergenic
1168888422 20:1276370-1276392 CACTCAGAGAGCAGGGCAAGGGG - Intronic
1169193291 20:3670880-3670902 GGTGCAGAGAGCAGCCCCAGAGG - Intronic
1173005039 20:39133767-39133789 GAGCCCCAGAGCAGCTCCAGTGG + Intergenic
1173827697 20:46058000-46058022 GAGCCAGGGAGCAGCGCCGGAGG - Intronic
1174026262 20:47578821-47578843 GATCCTGGGAGCAGTGCCAGTGG + Intronic
1175036105 20:56003475-56003497 TACCCAGGGAGCAGCCTCAGCGG + Intronic
1175585071 20:60132771-60132793 GACCCTGAGTGCAGCGTCACTGG + Intergenic
1178631718 21:34267200-34267222 AACGCACAGAGCAGCACCAGAGG - Intergenic
1179487951 21:41722765-41722787 GACACGGAGAGCAGAGCCCGTGG + Intergenic
1179988309 21:44932940-44932962 GACCCAGAGGCCAGCAGCAGAGG + Intronic
1180252906 21:46601372-46601394 GAGCCAGAGTGAAGCACCAGTGG - Intronic
1180972256 22:19821786-19821808 GAGCCAGAGGGCACAGCCAGTGG - Intronic
1182447580 22:30398415-30398437 GACCTAGAGGGCAGTCCCAGAGG - Intronic
1182926861 22:34133378-34133400 GAGCCAGAGTTCAGCCCCAGGGG + Intergenic
1183379205 22:37482398-37482420 GACAGAGAGAGAAGCCCCAGGGG - Intronic
1183402235 22:37611318-37611340 CTCCCAGAGAGCAGCTCCCGAGG + Intronic
1184368659 22:44068752-44068774 GGCCCAGAGAGCAAAGGCAGTGG + Intronic
1184651769 22:45922600-45922622 CACCCAGAGAGCAAGGCCAGGGG - Exonic
1185148427 22:49151422-49151444 GCCTCAGAGCGCAGTGCCAGGGG + Intergenic
950030064 3:9846387-9846409 GACCCAGAGAGCAGGCCCCAGGG + Intronic
950490387 3:13301176-13301198 TACCCAGAGATGAGAGCCAGAGG - Intergenic
950663469 3:14481296-14481318 GACCCAGAGTTCAGTGACAGAGG + Intronic
953906876 3:46872762-46872784 AAGCCAGGGAGCAGCCCCAGGGG - Intronic
954132255 3:48566752-48566774 GACCAAGTGAGCAGGGTCAGAGG + Intronic
955544559 3:60014051-60014073 GACCCAGAGAGTCGGGACAGTGG - Exonic
955769230 3:62372495-62372517 GCCCCAGTGTGCGGCGCCAGCGG - Exonic
959439344 3:106357940-106357962 GAGCCAGAGAACAAAGCCAGGGG - Intergenic
959612040 3:108305931-108305953 GATCCAGACAGCAGCACCTGGGG - Intronic
960950356 3:122995034-122995056 AACCCAGAGAGAAGAGGCAGAGG + Intronic
961651521 3:128418882-128418904 GGCCCAGAGAGCAGGGGCAGAGG - Intergenic
961933005 3:130554026-130554048 GGGCCAGAGAACAACGCCAGGGG - Intergenic
962362722 3:134755385-134755407 ATCCCAGAGAGCATCTCCAGGGG + Intronic
963397224 3:144750001-144750023 GAAATAGAGAGCAGCGCCAGTGG - Intergenic
964261381 3:154842028-154842050 GACCCAGAGATCAGCAACAATGG + Intergenic
965921954 3:173927834-173927856 GAACCCGAGAGCAGCTGCAGAGG + Intronic
968190868 3:196666181-196666203 GGCCCAGAGAAGAGAGCCAGGGG - Intronic
968481801 4:836452-836474 GAGCCAGAGAGCGGCGACGGTGG + Intergenic
968625837 4:1626348-1626370 GACCCAGACAGCAGAGCCCAGGG + Intronic
968814422 4:2814665-2814687 GCCCCAGAGAGCAGCTGCAGAGG + Intronic
971894865 4:32579461-32579483 GACCCAGAGACCAGCTGCAAAGG - Intergenic
973780348 4:54283031-54283053 GCCCCTGAGAGCAGCTGCAGGGG - Intronic
974914464 4:68162502-68162524 GAGCCAGAGAACAAAGCCAGGGG + Intergenic
978241387 4:106520945-106520967 GAGCCAGAGAGCAAAGCCAGGGG - Intergenic
979080438 4:116332251-116332273 GATTCAGAGAGCAGGCCCAGTGG - Intergenic
981504334 4:145482536-145482558 GCCTTGGAGAGCAGCGCCAGCGG - Intronic
983288215 4:165766294-165766316 AAGCCAGAGTGCAGCGCTAGCGG - Intergenic
984358807 4:178701206-178701228 TCCTCAGAGAGCAGTGCCAGTGG - Intergenic
985369041 4:189265701-189265723 GACCTAGAGATTAGAGCCAGGGG - Intergenic
986152426 5:5140084-5140106 GAGACAGCGGGCAGCGCCAGAGG - Intergenic
986402384 5:7394685-7394707 ATCCCAGAGGGCAGCCCCAGAGG - Intergenic
988728269 5:33944829-33944851 GACCCAGACAACAGCGTGAGAGG - Exonic
989615863 5:43336073-43336095 GAACCAGAGACCATCCCCAGAGG + Intergenic
991204878 5:64038946-64038968 GCCCAAGAGAGCAGCCACAGGGG + Intergenic
992084548 5:73266386-73266408 GACCCAGGCAGCAGCAGCAGAGG - Intergenic
992120318 5:73585905-73585927 GACCCAGAGGGCAGAGGCAAAGG + Intergenic
998340618 5:141414568-141414590 ATCCCAGAGAACAACGCCAGGGG + Exonic
998543406 5:143004779-143004801 GAGCAAGTGAGCAGAGCCAGAGG + Intronic
999142592 5:149372201-149372223 GACCTGGAGAGCAGCCCCAAGGG + Intronic
1003393005 6:5729405-5729427 GTCCCAGAGAGCAGGGGCTGAGG + Intronic
1004011374 6:11691282-11691304 GACCCAGAGACCAGTCACAGTGG + Intergenic
1005859009 6:29887488-29887510 GACCCTGAGAGCCACGCCTGGGG - Intergenic
1005905468 6:30259361-30259383 GACCCAGAGAGCCACGCCTGGGG - Intergenic
1006326176 6:33355715-33355737 GAACCAGAGACCACCCCCAGAGG + Intergenic
1011026624 6:82876360-82876382 GAGGCAGAGAGGAGAGCCAGTGG - Intergenic
1012960984 6:105621530-105621552 CACCCAGAGACTAGCGACAGTGG + Intergenic
1019051656 6:169188278-169188300 GACTCAGAGAGCACCTACAGCGG - Intergenic
1019297928 7:289023-289045 GACCCAGACAGCGGGGCCTGGGG - Intergenic
1020790235 7:12618116-12618138 GACACAGAGTGCAGCCCTAGAGG - Intronic
1023436766 7:40147772-40147794 GAACCAGAGACCACCCCCAGAGG + Intronic
1026371998 7:69709349-69709371 CACCTAGATAGCAGCACCAGTGG - Intronic
1028333480 7:89624659-89624681 GAACCAGAGACCATCCCCAGAGG - Intergenic
1028987590 7:97020746-97020768 GTCCCGGAGGCCAGCGCCAGCGG + Exonic
1029571293 7:101371319-101371341 GAACCAGAGAGCAAAGGCAGGGG - Intronic
1030007773 7:105135429-105135451 GGACCAGAGAGCAGCAGCAGAGG + Intronic
1031032784 7:116752696-116752718 GACGCAGAGAGCTGCGCAACTGG - Intronic
1032478182 7:132226411-132226433 AACCCTGAGAGCAGCTGCAGAGG + Intronic
1034911947 7:155003855-155003877 GTCCCAGACAGCAGAGCCCGCGG + Intergenic
1035198085 7:157239899-157239921 CACCCAGAAAGCAGCAACAGTGG - Intronic
1041592971 8:59611365-59611387 CACCCAGAGAGGAGCTACAGAGG - Intergenic
1042088449 8:65132965-65132987 GAACCAGAGACCATCCCCAGAGG + Intergenic
1045483303 8:102610327-102610349 CACACAGAAAGCAGAGCCAGGGG - Intergenic
1045810991 8:106219998-106220020 GACACAGAGAGCAGAGACAGTGG - Intergenic
1046625526 8:116572751-116572773 GACCCAGAGGCCAGTGCCAAAGG + Intergenic
1047766295 8:127992705-127992727 TATCCAGGGAGCAGGGCCAGGGG - Intergenic
1049582896 8:143420836-143420858 GACCCAGAGGGCAGAGACGGTGG + Intronic
1049686425 8:143941067-143941089 GACCCAGGGAGGGGCGGCAGAGG - Intronic
1053545002 9:39013799-39013821 GTCCAAGAAAGCAGAGCCAGGGG - Intergenic
1057046497 9:91890177-91890199 GAACCAGAGAGCAGCCCAAAGGG + Intronic
1057315265 9:93964366-93964388 GGCCCAGAGAGCATCCCCATGGG - Intergenic
1060877268 9:127092404-127092426 GACCTAGAGGGGAGCGCCGGTGG - Intronic
1061209802 9:129184478-129184500 GACCCACATAGCAGCGAGAGAGG - Intergenic
1061908729 9:133711856-133711878 GACCCACACAGCAGGGCCTGTGG - Intronic
1062003330 9:134227585-134227607 AAGGCAGAGAGCAGCGCCACAGG - Intergenic
1062043173 9:134413492-134413514 GACCCAGAGAGCAGCGCCAGAGG - Intronic
1062118684 9:134822520-134822542 GACCCAGGCAGCGGTGCCAGAGG - Intronic
1062623609 9:137433446-137433468 GACCCAGGGAGCAGGTGCAGGGG + Exonic
1187682272 X:21779281-21779303 GTAGCAGAGAGCAGAGCCAGGGG - Intergenic
1189295509 X:39914899-39914921 GACCCAGAGAGGAGCTGCCGTGG - Intergenic
1191001096 X:55660397-55660419 GGCCCAGAGAGCAGCGACCTGGG + Intergenic
1199706358 X:150428769-150428791 GACCCAGGAAGCAGGGCCAATGG - Intronic
1202069517 Y:20976225-20976247 AACTCAGAGACCAGTGCCAGTGG - Intergenic