ID: 1062043176

View in Genome Browser
Species Human (GRCh38)
Location 9:134413522-134413544
Sequence CTGGCCTCCTCTTAAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043176_1062043185 -3 Left 1062043176 9:134413522-134413544 CCCCACCCTTAAGAGGAGGCCAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043176_1062043191 25 Left 1062043176 9:134413522-134413544 CCCCACCCTTAAGAGGAGGCCAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1062043191 9:134413570-134413592 CCTGTCTTGGGCCCAGCCCTGGG No data
1062043176_1062043183 -10 Left 1062043176 9:134413522-134413544 CCCCACCCTTAAGAGGAGGCCAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1062043183 9:134413535-134413557 AGGAGGCCAGAATGGTTTGGTGG No data
1062043176_1062043186 12 Left 1062043176 9:134413522-134413544 CCCCACCCTTAAGAGGAGGCCAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1062043186 9:134413557-134413579 GAGTTCGGTCCTGCCTGTCTTGG No data
1062043176_1062043189 24 Left 1062043176 9:134413522-134413544 CCCCACCCTTAAGAGGAGGCCAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1062043189 9:134413569-134413591 GCCTGTCTTGGGCCCAGCCCTGG No data
1062043176_1062043187 13 Left 1062043176 9:134413522-134413544 CCCCACCCTTAAGAGGAGGCCAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1062043187 9:134413558-134413580 AGTTCGGTCCTGCCTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043176 Original CRISPR CTGGCCTCCTCTTAAGGGTG GGG (reversed) Intronic
900484935 1:2918086-2918108 CTGGGGTCCTCTGAAGGGTGGGG + Intergenic
904089504 1:27934947-27934969 GTGGCTTCCACTTAAGGGTCCGG + Intergenic
905272667 1:36797072-36797094 CTGCCCTCTTCTTCAGGGTCTGG + Exonic
909877339 1:80824221-80824243 CTTGCCTCCTGTGAAGTGTGAGG - Intergenic
912563057 1:110564002-110564024 GTGGCCCTCTCTTTAGGGTGTGG + Intergenic
915110024 1:153558126-153558148 CACGCCTATTCTTAAGGGTGTGG - Intergenic
915824809 1:159064328-159064350 CTGGCCTCCTCCTAAAGGAAGGG - Intronic
922698367 1:227743288-227743310 CTGGCCTCCTCTTCTGGGGAGGG - Intronic
924058204 1:240144242-240144264 CTGGCCTCCTCTTTTGTGAGTGG - Intronic
1062908883 10:1199489-1199511 CTGGCAGCCTCTGGAGGGTGTGG + Intronic
1063933194 10:11050126-11050148 CTGGCCTCCTGCTAAGGGCAGGG + Intronic
1067784025 10:49229538-49229560 CTGGCCTCCCCTTCAAGGAGTGG - Intergenic
1067832132 10:49616395-49616417 CTGGCCTCCTCATGGGGCTGGGG + Intronic
1069117578 10:64527375-64527397 CTGCCCTCATCTTATTGGTGAGG + Intergenic
1070411066 10:76141000-76141022 CTGCCCTCTTCTTAGGGGAGAGG - Intronic
1074127747 10:110543205-110543227 CTGGCCTCCAGTGAAGGGAGTGG - Intergenic
1074151722 10:110765232-110765254 ATGGGCATCTCTTAAGGGTGAGG + Intronic
1076052394 10:127346190-127346212 CTGGCATCTTCTTAGTGGTGGGG + Intronic
1078464775 11:11541981-11542003 CTGGGGTCTTCTGAAGGGTGGGG - Intronic
1083308224 11:61771759-61771781 CTGGCCAACTCTTCAAGGTGGGG + Intronic
1083334778 11:61916377-61916399 GTGGGCTCCTGTTAGGGGTGAGG - Intronic
1089286166 11:117409474-117409496 CTGACCCCCTCATAAGGTTGAGG + Intronic
1090803785 11:130190161-130190183 CCCGCCTCCTCTTCTGGGTGGGG + Intronic
1091040854 11:132279884-132279906 CTGTCCATCTCTTAATGGTGAGG + Intronic
1091070281 11:132556659-132556681 CTGACCTCCTCTTAATGCAGTGG - Intronic
1091418103 12:308217-308239 TTGGCCTCTTCTGTAGGGTGCGG + Intronic
1092314567 12:7396735-7396757 CTGGCCTCCTCTTCAGATTTTGG + Intronic
1094221504 12:27998444-27998466 CAGGCTTCCTGTTAAGGTTGTGG + Intergenic
1094285979 12:28794005-28794027 CTGAATTCCTCTAAAGGGTGAGG + Intergenic
1095294128 12:40509222-40509244 CTTGCCTCCTGTTAAAGTTGCGG - Intronic
1095967655 12:47879615-47879637 GTCTCCTCCTCTTGAGGGTGGGG + Intronic
1096504700 12:52085392-52085414 ATTCCCTCCTCTTTAGGGTGGGG + Intergenic
1096606862 12:52772872-52772894 CTGACCTCCTCTGCAGGATGTGG - Exonic
1103883362 12:124183295-124183317 GTGGCCTCTTCTTCAGGGTTAGG - Intronic
1104127270 12:125860308-125860330 CTGGCCTGCTCTAAAGAATGGGG - Intergenic
1106136210 13:26975658-26975680 CAAGCCTCCATTTAAGGGTGGGG - Intergenic
1107173055 13:37366529-37366551 CTTGCCTCCTCTTAGTGCTGTGG + Intergenic
1108519991 13:51237990-51238012 GAGGCCTCCTCTTAGGGCTGGGG + Intronic
1108640931 13:52381627-52381649 CTGTCCTCCTATAAAAGGTGAGG + Intronic
1110727249 13:78839701-78839723 CTGACCTCTTCCTTAGGGTGGGG + Intergenic
1112234288 13:97621647-97621669 CTGGCCTCATCTTCATGCTGAGG + Intergenic
1115645406 14:35365724-35365746 GTGGCCTCCCCCTCAGGGTGGGG - Intergenic
1117792390 14:59354477-59354499 CTGGGCTCCTCTACAGGGTTGGG + Intronic
1118332208 14:64823527-64823549 CTGGCCTAGTCCTCAGGGTGAGG - Intronic
1119386647 14:74261503-74261525 CTGGACTCCACTGATGGGTGGGG - Exonic
1121180913 14:91928015-91928037 CTGGCCTCATGTTCTGGGTGGGG - Intronic
1124115479 15:26838961-26838983 CTGGCCTCCTCGGAAGGGCAGGG - Intronic
1124346816 15:28928581-28928603 CTGGCCTCCTGTTTGGGGTCTGG - Intronic
1124603314 15:31152089-31152111 CTGGCCTGCTCTCAAGCTTGGGG + Intronic
1126782994 15:52154409-52154431 CTGCCCTCCTCTTAGAGCTGTGG - Intronic
1127627964 15:60798826-60798848 CTTGCCTCCACTTTAGAGTGGGG - Intronic
1132355421 15:101168035-101168057 CTGGCTTCCTCTTCAGGAGGAGG + Intergenic
1134583012 16:15387729-15387751 CAGGGCTCCACATAAGGGTGCGG - Intergenic
1135055866 16:19231659-19231681 CTGGCCGCCTGTTATGGCTGAGG + Intronic
1135425054 16:22328314-22328336 CTGGCCTCCTCCCCATGGTGAGG + Intronic
1136178897 16:28537660-28537682 CTGGCCTCATCTGGGGGGTGAGG + Exonic
1136193276 16:28631648-28631670 CAGGACTCCACATAAGGGTGTGG + Intergenic
1136311178 16:29411949-29411971 CAGGACTCCACATAAGGGTGTGG - Intergenic
1137614434 16:49838526-49838548 CGGGCCTCCGCTTTGGGGTGGGG - Intronic
1137984860 16:53099218-53099240 GGGGCCTCCTTTCAAGGGTGCGG - Intronic
1139754311 16:69131392-69131414 CTGTCCTCCTCTTAATGGTACGG + Intronic
1139858693 16:70002881-70002903 CAGGACTCCACATAAGGGTGTGG - Intergenic
1140786741 16:78349494-78349516 CTGGCTTCTTCTAAAGGGTGGGG - Intronic
1143230584 17:5350810-5350832 ATGGCCTCCTCTCGGGGGTGGGG + Intronic
1143308915 17:5972160-5972182 CTGGCCTTCCCTTAACAGTGTGG + Intronic
1144853814 17:18257487-18257509 CTGGCCTGCCCTGCAGGGTGGGG - Intronic
1145786584 17:27597727-27597749 CTGCCCTCCTCTTCATGGGGTGG + Intronic
1145868793 17:28257120-28257142 CCGGCCTCCTCTTAGGAATGTGG - Intergenic
1146615985 17:34357803-34357825 CTGGCATCTGCTAAAGGGTGTGG - Intronic
1147178212 17:38669811-38669833 CTACCCTCCTCTTCAGGGTCTGG - Intergenic
1148013033 17:44500805-44500827 GTGGCCTCCTTTTAAGGTTTTGG - Intronic
1149348451 17:55762793-55762815 CTGGTCTCCTCTGCAGGGAGAGG - Intronic
1151438779 17:74114951-74114973 CTGGCCTGCCCATCAGGGTGTGG + Intergenic
1151627426 17:75285950-75285972 CTGCCCTCCTCATGACGGTGTGG + Intronic
1156485762 18:37464585-37464607 CTGGCCTGCTGTTTTGGGTGTGG + Intronic
1156929364 18:42622561-42622583 GTGCCCTCCTCTTTATGGTGGGG + Intergenic
1158718034 18:59898333-59898355 CTAGGTTCCTCTAAAGGGTGTGG + Intergenic
1159548885 18:69874488-69874510 CTGGCATCATCCTAATGGTGGGG - Intronic
1160623617 18:80188247-80188269 CTGGCCTCTCCCTAAGGGCGTGG + Intronic
1161802060 19:6421790-6421812 CTCAGCTCCTGTTAAGGGTGGGG - Intronic
1161944965 19:7429739-7429761 AGAGCCTCCTCTTATGGGTGTGG - Intronic
1162947268 19:14051684-14051706 CTGGCCACCTCTGGAAGGTGAGG + Exonic
1163554744 19:17985443-17985465 CTGGCATCATGGTAAGGGTGAGG + Exonic
1164601279 19:29565254-29565276 CTGGCCTCCTGTGGCGGGTGGGG + Intergenic
1165385470 19:35507986-35508008 CTGGTCCCCTCTTAAGGGAGAGG + Intronic
1166910059 19:46148144-46148166 CTGGCCTCTTGGAAAGGGTGGGG - Intronic
1167048354 19:47064888-47064910 CTTCCCTCCTCCTCAGGGTGGGG - Exonic
929438735 2:41948871-41948893 CTGGGGTCCTCTTTAGGGTTTGG + Intronic
932116739 2:69057238-69057260 CTTGCCTCCTGTTGAGGGTAGGG + Intronic
935152340 2:100449379-100449401 CTGGTATCGGCTTAAGGGTGGGG - Intergenic
937032240 2:118750387-118750409 ATGGCCTCCACTTGAGGGAGGGG - Intergenic
937395079 2:121528149-121528171 CTGTCCTCATTTTATGGGTGAGG + Intronic
937925136 2:127162325-127162347 CTGGTCTCCTCTCCAGGGTGAGG - Intergenic
940240765 2:151560811-151560833 CAGGACTCCTCTTTAAGGTGGGG + Intronic
944108400 2:196104197-196104219 CTGGCCTCTTTTGAAGGTTGTGG + Intergenic
946759857 2:222982765-222982787 TGCCCCTCCTCTTAAGGGTGAGG + Intergenic
947571623 2:231240222-231240244 CTGGCCTCCTAGGGAGGGTGAGG + Intronic
948897907 2:240935730-240935752 CTGGCCTCCCCGTGGGGGTGGGG + Intronic
1169514835 20:6304260-6304282 CTGGCCTCCTACTAAAGGAGGGG - Intergenic
1170172828 20:13434517-13434539 CTGGCCTCCTGATAAAGCTGTGG - Intronic
1170840755 20:19922996-19923018 CTGTCCTCCTTTTAAGCTTGAGG + Intronic
1174983942 20:55428573-55428595 GTGCCCACCTCTTCAGGGTGAGG + Intergenic
1175949586 20:62576289-62576311 GTGGCCTCCAGCTAAGGGTGTGG - Intergenic
1179075360 21:38115358-38115380 CTGGCATGCTATTGAGGGTGAGG - Intronic
1180745440 22:18085428-18085450 CTGGCCTCTCCTTATGGGTGGGG - Intronic
1183463336 22:37966406-37966428 CTGGCCTCAGGTGAAGGGTGGGG + Intronic
1184413414 22:44338533-44338555 CTGGCCTCCTCTGAGGTGTAAGG + Intergenic
949628187 3:5891638-5891660 CTGGCGTCTTGTTAAGGGAGTGG - Intergenic
950263037 3:11555596-11555618 CTGGCCTGCTCATAAGGGCAGGG - Exonic
954117426 3:48474903-48474925 CTGGCCTCTTCTGCATGGTGGGG - Intronic
957107172 3:75905715-75905737 CTGGCCTCTTTTTTAGAGTGGGG + Intergenic
957805328 3:85140888-85140910 CTGTTCTCCTCCTTAGGGTGGGG + Intronic
961397892 3:126609778-126609800 CTGACCTCCTCATGAGGGTGTGG - Intronic
965663303 3:171065079-171065101 CCAGCCTACTCCTAAGGGTGTGG + Intronic
967940095 3:194759012-194759034 ATGGTCTCCTCTGAAGGGAGTGG - Intergenic
968600903 4:1508918-1508940 CGGGCCGCCACTGAAGGGTGGGG + Intergenic
973931478 4:55796891-55796913 CTGGGCTCCTCCCAAGGGAGTGG + Intergenic
976891812 4:90057750-90057772 CTGGCTTCATCTGAAGGCTGTGG + Intergenic
977419482 4:96780001-96780023 CTGGCCTCCTCTGCTGGGAGTGG + Intergenic
979799857 4:124894946-124894968 CTTGCCCCTCCTTAAGGGTGTGG + Intergenic
984702700 4:182828332-182828354 CTGGCTGCCTCTCAGGGGTGAGG + Intergenic
985764106 5:1767965-1767987 CTGGCCTCCCTTTTGGGGTGAGG - Intergenic
987226082 5:15842623-15842645 ATGCCCTCATGTTAAGGGTGGGG + Intronic
990982921 5:61617729-61617751 CTGGCTTTCTCTTAAGAGGGAGG + Intergenic
994115724 5:96059576-96059598 GTGGCTTCCTGTTAAGGGAGTGG + Intergenic
995887681 5:116914605-116914627 CTGGCTGCCTCTTAAGAATGAGG + Intergenic
996149368 5:120016664-120016686 CTGGCCCCCTCTTAAGATGGAGG - Intergenic
997294227 5:132759864-132759886 CTGGACTCCAGCTAAGGGTGTGG + Intronic
999252475 5:150190748-150190770 CTGGACTCATCTGAGGGGTGGGG + Intronic
1000246297 5:159451233-159451255 CTGGCCTCCTTTTCAGGGATTGG - Intergenic
1000285101 5:159819956-159819978 CTGCCCTCCTCCTAGGGATGGGG + Intergenic
1000918772 5:167113991-167114013 CTGTGCTCCTCTCAAGGGTGTGG + Intergenic
1001512888 5:172336299-172336321 GGGGCCTCCTCTCAAGGGAGGGG + Exonic
1004817610 6:19329630-19329652 CTGGGTTCCACTTGAGGGTGGGG - Intergenic
1005768176 6:29036107-29036129 CTGGCCTCCTCTTTAGGCCACGG - Intergenic
1007329393 6:41093016-41093038 CTTGCCTCCTCTTAAGAATACGG - Exonic
1014543687 6:122706650-122706672 CTGTCTTCATTTTAAGGGTGAGG - Intronic
1017021704 6:150144461-150144483 GTGACCTCCTCTTAAGGGAGTGG + Intronic
1017453753 6:154578870-154578892 TTGTCCTCATTTTAAGGGTGAGG + Intergenic
1018607552 6:165613977-165613999 CTGGCCTCCAGTTTTGGGTGTGG - Intronic
1021202420 7:17741586-17741608 CTGGCCACCTCTTAGTGGGGTGG - Intergenic
1022503006 7:30894278-30894300 CTGGCCTCCTCTTTTGTGAGGGG + Intergenic
1029186633 7:98743708-98743730 CTGGCCTACTGTCAAGGATGTGG + Intergenic
1029505461 7:100961108-100961130 CCAGCCACCTCCTAAGGGTGAGG - Intronic
1032018832 7:128395471-128395493 CTGTCATGCTCTTAGGGGTGGGG - Intronic
1033420559 7:141201197-141201219 CTGGCCTCCTCTTAGCTTTGTGG - Intronic
1033967717 7:146997559-146997581 CTGGCCTCATCTAATGGGTTTGG + Intronic
1035031841 7:155865905-155865927 CTACCCTCCTCTTTAGGGAGAGG + Intergenic
1036190999 8:6670717-6670739 CTTGCTCCCTCTAAAGGGTGTGG - Intergenic
1038487628 8:27948236-27948258 CAGGCCTCCTCCCCAGGGTGAGG + Intronic
1038628427 8:29217169-29217191 CAGGCCTCCTCTACAGGGTGGGG - Intronic
1038748901 8:30278253-30278275 CTGCCATCCTCTCGAGGGTGTGG + Intergenic
1044629498 8:94264860-94264882 CTGGGATCATCTTGAGGGTGTGG + Intergenic
1046567323 8:115918018-115918040 CTGACCCCCTCATAGGGGTGTGG - Intergenic
1048870294 8:138791655-138791677 TTGGCATCCTCTTCAGGATGTGG + Intronic
1049271425 8:141698277-141698299 ATGGTCTCGTCTGAAGGGTGGGG - Intergenic
1049605381 8:143526828-143526850 CTGGCCTCCTGTTGAGGGACTGG - Intronic
1052121809 9:24727340-24727362 CTGTCTTCTTCTTAAGGGTAGGG - Intergenic
1057528807 9:95826041-95826063 CATGCCTCCTCTGAAGGGTCTGG - Intergenic
1059246249 9:112852119-112852141 CAGGCCTCCTCTTACTGGGGAGG + Intronic
1059417881 9:114173201-114173223 CTCGCCTCCTCTCAGGCGTGGGG - Intronic
1060175175 9:121492426-121492448 CTCGGCTCCCCTTAGGGGTGAGG - Intergenic
1062043176 9:134413522-134413544 CTGGCCTCCTCTTAAGGGTGGGG - Intronic
1189245484 X:39560317-39560339 TTTGCATTCTCTTAAGGGTGTGG - Intergenic
1189375932 X:40466420-40466442 CTGGCCTCCACTGAAGGGGCTGG - Intergenic
1193223845 X:78958465-78958487 CTGGCTTGCTCTGAAGCGTGTGG - Intronic
1200047648 X:153411296-153411318 CTGGGCTGCTCTGAAGGCTGGGG - Intergenic
1200360528 X:155601011-155601033 CTGGCCTCCCCCACAGGGTGTGG - Intronic
1202366640 Y:24170391-24170413 CTGGCTTCCTCTTGAGACTGAGG - Intergenic
1202504142 Y:25499732-25499754 CTGGCTTCCTCTTGAGACTGAGG + Intergenic