ID: 1062043177

View in Genome Browser
Species Human (GRCh38)
Location 9:134413523-134413545
Sequence TCTGGCCTCCTCTTAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043177_1062043191 24 Left 1062043177 9:134413523-134413545 CCCACCCTTAAGAGGAGGCCAGA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1062043191 9:134413570-134413592 CCTGTCTTGGGCCCAGCCCTGGG No data
1062043177_1062043185 -4 Left 1062043177 9:134413523-134413545 CCCACCCTTAAGAGGAGGCCAGA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043177_1062043187 12 Left 1062043177 9:134413523-134413545 CCCACCCTTAAGAGGAGGCCAGA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1062043187 9:134413558-134413580 AGTTCGGTCCTGCCTGTCTTGGG No data
1062043177_1062043189 23 Left 1062043177 9:134413523-134413545 CCCACCCTTAAGAGGAGGCCAGA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1062043189 9:134413569-134413591 GCCTGTCTTGGGCCCAGCCCTGG No data
1062043177_1062043186 11 Left 1062043177 9:134413523-134413545 CCCACCCTTAAGAGGAGGCCAGA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1062043186 9:134413557-134413579 GAGTTCGGTCCTGCCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043177 Original CRISPR TCTGGCCTCCTCTTAAGGGT GGG (reversed) Intronic
900484934 1:2918085-2918107 CCTGGGGTCCTCTGAAGGGTGGG + Intergenic
902254332 1:15177825-15177847 TCTCGCTTCCTCTTTAGGGATGG - Intronic
906644504 1:47464119-47464141 ACTAGACTCCTCTTCAGGGTTGG + Intergenic
912919328 1:113850428-113850450 TCAGGCCTACTTTTAAGAGTTGG - Intronic
914243804 1:145871521-145871543 TCTCGCCTCCACTTCAGGGTGGG - Intronic
915069280 1:153252688-153252710 TCTGGTCTGTTCTGAAGGGTAGG - Intergenic
915824810 1:159064329-159064351 CCTGGCCTCCTCCTAAAGGAAGG - Intronic
920230222 1:204465315-204465337 TCTGCTCTTCTCTTAAAGGTGGG - Exonic
922233514 1:223706085-223706107 TCTTGCCTCCTGGCAAGGGTGGG + Intronic
922698368 1:227743289-227743311 GCTGGCCTCCTCTTCTGGGGAGG - Intronic
924091159 1:240502425-240502447 TGTGCTCTCCTCTTAAAGGTTGG + Intronic
1063933193 10:11050125-11050147 ACTGGCCTCCTGCTAAGGGCAGG + Intronic
1067358827 10:45557722-45557744 TGTGGCCTCCTCTTAGCTGTGGG - Intronic
1067832131 10:49616394-49616416 TCTGGCCTCCTCATGGGGCTGGG + Intronic
1076408631 10:130230612-130230634 GCTGGCCTCCACTGAAGGGAGGG + Intergenic
1077147449 11:1052453-1052475 TCTGGCCCCCCCTTATGGGGAGG - Intergenic
1078464776 11:11541982-11542004 TCTGGGGTCTTCTGAAGGGTGGG - Intronic
1078854089 11:15192151-15192173 TCTGGGCTCCTCTTCAGCCTGGG - Intronic
1083445919 11:62707971-62707993 TGTGCCCTCCTCATCAGGGTTGG + Intronic
1086968900 11:93059078-93059100 TCTGCCCTGCTCTCAAGTGTTGG + Intergenic
1086992165 11:93315260-93315282 TCTGTCCTCCTCTTCAGTCTGGG + Intergenic
1088451782 11:109989084-109989106 TCTTGCCTGCTCTTTAGGCTTGG - Intergenic
1089756069 11:120688316-120688338 TCTGACTTCCTCTTCGGGGTAGG - Intronic
1091785973 12:3243661-3243683 CCTGGCTTCCTCTTCAGGGAGGG + Intronic
1092505300 12:9092462-9092484 TCTGGCTGTCTCCTAAGGGTTGG + Intronic
1093772470 12:23033567-23033589 TCTGGGCTCCTCTTCAGAGATGG - Intergenic
1106136211 13:26975659-26975681 TCAAGCCTCCATTTAAGGGTGGG - Intergenic
1107567603 13:41621942-41621964 TCTGGGCTCCTATTTGGGGTTGG - Intronic
1108122923 13:47209009-47209031 TCTTGCCTCCTTTTGAGGTTTGG - Intergenic
1108721463 13:53136961-53136983 TCTGGCCCACTCTCAAGGGGAGG + Intergenic
1117792389 14:59354476-59354498 CCTGGGCTCCTCTACAGGGTTGG + Intronic
1117809578 14:59532579-59532601 TCTGGCCTTCCCTTGTGGGTGGG + Intronic
1119386648 14:74261504-74261526 TCTGGACTCCACTGATGGGTGGG - Exonic
1119430634 14:74566274-74566296 TCTGTCTGCCTCTTAAGCGTTGG - Intronic
1120776013 14:88438960-88438982 TCTTGCCCACACTTAAGGGTTGG + Intronic
1121123889 14:91393486-91393508 TCTGGCTTCCTCTGAAGGTCTGG + Intronic
1121841440 14:97137634-97137656 TCTGGCTCCCTCTAAACGGTGGG - Intergenic
1122509240 14:102252819-102252841 TCTGGAATCTTGTTAAGGGTTGG - Intronic
1122936055 14:104956775-104956797 TCTGGGCCCCTCTGAAGGGAGGG - Intronic
1124115480 15:26838962-26838984 CCTGGCCTCCTCGGAAGGGCAGG - Intronic
1126676098 15:51160380-51160402 CCTGCCCCCCTCTGAAGGGTGGG - Intergenic
1126852694 15:52806567-52806589 TCTGGCCTTCTCTAGAGGGAGGG - Intergenic
1127731567 15:61806978-61807000 TCTGGCCTCCCCTCCAGGGAAGG + Intergenic
1128146092 15:65333223-65333245 CCTGCCCTCCTCCTCAGGGTTGG + Intronic
1129062337 15:72870008-72870030 CCTGACCTCCTTTTAGGGGTAGG + Intergenic
1134405645 16:13956381-13956403 TCTTGCCACCTCCTAAGTGTAGG - Intergenic
1137614435 16:49838527-49838549 TCGGGCCTCCGCTTTGGGGTGGG - Intronic
1137841887 16:51648678-51648700 TCTGGACTCCTCTGCGGGGTTGG + Intergenic
1139308253 16:66006437-66006459 TCTGCCCTCCTTTTAGAGGTGGG + Intergenic
1140475528 16:75237796-75237818 TGTAGCCTCCTCAGAAGGGTTGG + Intronic
1140786742 16:78349495-78349517 CCTGGCTTCTTCTAAAGGGTGGG - Intronic
1141421068 16:83915843-83915865 TCTGGCATCCTCCTAAGGACCGG + Exonic
1142372676 16:89691754-89691776 TCCGGCCTTCTCCTAAGGGGTGG - Intronic
1143882543 17:10040662-10040684 TCTTGCCTCCTCTTCATGGCTGG - Intronic
1147615467 17:41824822-41824844 TTTCCCCTCCTCTTATGGGTCGG - Intergenic
1156308918 18:35904938-35904960 CCTGGCCTCCTCTTCCAGGTGGG + Intergenic
1161802061 19:6421791-6421813 TCTCAGCTCCTGTTAAGGGTGGG - Intronic
1162143301 19:8597342-8597364 CCTGGGCTCCTCTTAAGACTCGG - Intronic
1168238249 19:55076584-55076606 TCTGGCTTCCTCCTGAGTGTCGG - Intronic
928276903 2:29909781-29909803 TTAAGCCTCCTCTTAAGGTTTGG - Intronic
932116738 2:69057237-69057259 ACTTGCCTCCTGTTGAGGGTAGG + Intronic
935182199 2:100701248-100701270 ACTGGCCTCCCCTAAAGGGTGGG + Intergenic
935278157 2:101493665-101493687 TGTTGCCTCCTCTTGAGGGGAGG - Intergenic
935451095 2:103210401-103210423 TTTGACTTCTTCTTAAGGGTGGG + Intergenic
937646617 2:124272489-124272511 TCTGCCCTCCTCTGAAGAGGTGG - Intronic
938761994 2:134434268-134434290 TCTCACCTCTTCTTCAGGGTTGG + Intronic
944988175 2:205203290-205203312 TCTGGGCTCCTCTTAAAACTTGG + Intronic
946026166 2:216673208-216673230 GCTGGCCTCCCCTAGAGGGTGGG - Exonic
946157363 2:217815770-217815792 TCTGCCCTCATCTTCATGGTGGG - Intronic
946373519 2:219294812-219294834 TCAGGCCTGCTTTTAGGGGTGGG + Intronic
946996193 2:225394640-225394662 TCTGGCGTCCTCATATGGGGTGG - Intergenic
947704761 2:232265262-232265284 TCTGTCCACCACTTTAGGGTTGG + Intronic
948176199 2:235945418-235945440 TGTGGCCTCCATTTAATGGTGGG - Intronic
1173052632 20:39578942-39578964 TCTTGCCTGCACTTAAAGGTTGG + Intergenic
1175159140 20:56995139-56995161 TCTGGCCTCCTCCAGGGGGTTGG + Intergenic
1175259956 20:57668000-57668022 TCTGTCTTCCTCTTGAGGTTTGG + Intronic
1178083717 21:29092314-29092336 TCTTGCCTCCTCTTTAGAGAGGG - Intronic
1180745441 22:18085429-18085451 ACTGGCCTCTCCTTATGGGTGGG - Intronic
1182281539 22:29220333-29220355 CCTGGCCTCCTCCTCAGGGTAGG - Intronic
950263038 3:11555597-11555619 CCTGGCCTGCTCATAAGGGCAGG - Exonic
952043942 3:29294673-29294695 TGTGGCTTCCTTTTATGGGTTGG + Intronic
954787787 3:53107501-53107523 TCTGACCTCCCCTTAAGACTTGG - Intronic
957107171 3:75905714-75905736 TCTGGCCTCTTTTTTAGAGTGGG + Intergenic
957219841 3:77367624-77367646 TGTTGCCTGCTCTTAAAGGTTGG - Intronic
958792632 3:98669562-98669584 TCTTGCCTCATCTTAAAAGTTGG - Intergenic
960510449 3:118542837-118542859 TCAGTCCTCCTATCAAGGGTTGG - Intergenic
962081811 3:132147707-132147729 TCTAGACACCTGTTAAGGGTAGG - Intronic
963003282 3:140703389-140703411 ACTGGCATCCTCTTTAGGGTTGG - Intergenic
965930081 3:174031339-174031361 TCTGGGCTTCTCTTTAGGATGGG - Intronic
969370983 4:6731517-6731539 ACTGGCCTCCTCCTAGGAGTTGG - Intergenic
978802987 4:112772851-112772873 TTTCACCTCCACTTAAGGGTAGG + Intergenic
979723416 4:123931216-123931238 TATGGCCTCATCTAAAGGTTAGG + Intergenic
981541860 4:145854393-145854415 TTCCTCCTCCTCTTAAGGGTAGG - Intronic
983273082 4:165586351-165586373 TCTGTCCTCCTCTTAAAGGATGG + Intergenic
990690517 5:58358811-58358833 TCTGGCCTTCCCTGAAGGGGAGG - Intergenic
993809907 5:92463446-92463468 TTTGGCCTCCTGGTAAGGTTTGG - Intergenic
997346010 5:133192698-133192720 ACTGGCCTCCCCTTAAGGAGGGG + Intergenic
998213635 5:140220610-140220632 TCTGGACTCCTCTGCAGGGTTGG + Intronic
1001512887 5:172336298-172336320 TGGGGCCTCCTCTCAAGGGAGGG + Exonic
1006522269 6:34577944-34577966 CCTGATCTCCTCATAAGGGTTGG - Intergenic
1007410946 6:41661043-41661065 TCTAGCCTCCTCTTATGGTTTGG - Intergenic
1007722115 6:43891197-43891219 TCTCTGCTCCTCTTAAGGCTGGG + Intergenic
1012961893 6:105630870-105630892 TCTGTCCACCTCTTAAATGTTGG - Intergenic
1015895503 6:138012796-138012818 TCTGGCCTCCACTTAAATGTTGG - Intergenic
1028581922 7:92417728-92417750 TCTGGCCTGCCCTCATGGGTAGG + Intergenic
1029645025 7:101849089-101849111 CCTGTCCTTCTCTGAAGGGTGGG + Intronic
1030517436 7:110555529-110555551 AATGTCCTCCTCTTGAGGGTGGG + Intergenic
1030640969 7:112006045-112006067 TTAGCCCTCCTCTTAAAGGTTGG + Intronic
1036760398 8:11504735-11504757 TCAGGCCTCATCTCAAGGGTGGG - Intronic
1038628428 8:29217170-29217192 GCAGGCCTCCTCTACAGGGTGGG - Intronic
1040552625 8:48450370-48450392 TCTAGTCTTCTCTTAGGGGTTGG - Intergenic
1043548117 8:81337920-81337942 TCTCTCCTCCTCTAAAGGGAAGG + Intergenic
1052121810 9:24727341-24727363 TCTGTCTTCTTCTTAAGGGTAGG - Intergenic
1055419081 9:76117597-76117619 TTTGGCCTTCTATTAAGGCTTGG - Intronic
1055438276 9:76314318-76314340 TATGCCCTCCTGTTATGGGTAGG + Intronic
1060418351 9:123449218-123449240 TTTAAGCTCCTCTTAAGGGTGGG - Intronic
1061591313 9:131599521-131599543 TCTGGCCTCGTCTAAAGGTCGGG + Intronic
1062043177 9:134413523-134413545 TCTGGCCTCCTCTTAAGGGTGGG - Intronic
1192452160 X:71251363-71251385 TCTTCCCTCCTCCTAAGGGCTGG - Intronic
1192964843 X:76166405-76166427 TGTTGCATCCTCTTGAGGGTAGG + Intergenic
1196698890 X:118644765-118644787 TGTGGACTCATCTTAAGAGTTGG + Intronic
1196813699 X:119648143-119648165 TCTGGCCTCCTGCTAAGCCTAGG - Intronic
1200047649 X:153411297-153411319 TCTGGGCTGCTCTGAAGGCTGGG - Intergenic