ID: 1062043178

View in Genome Browser
Species Human (GRCh38)
Location 9:134413524-134413546
Sequence TTCTGGCCTCCTCTTAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043178_1062043186 10 Left 1062043178 9:134413524-134413546 CCACCCTTAAGAGGAGGCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1062043186 9:134413557-134413579 GAGTTCGGTCCTGCCTGTCTTGG No data
1062043178_1062043185 -5 Left 1062043178 9:134413524-134413546 CCACCCTTAAGAGGAGGCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043178_1062043187 11 Left 1062043178 9:134413524-134413546 CCACCCTTAAGAGGAGGCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1062043187 9:134413558-134413580 AGTTCGGTCCTGCCTGTCTTGGG No data
1062043178_1062043189 22 Left 1062043178 9:134413524-134413546 CCACCCTTAAGAGGAGGCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1062043189 9:134413569-134413591 GCCTGTCTTGGGCCCAGCCCTGG No data
1062043178_1062043191 23 Left 1062043178 9:134413524-134413546 CCACCCTTAAGAGGAGGCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1062043191 9:134413570-134413592 CCTGTCTTGGGCCCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043178 Original CRISPR TTCTGGCCTCCTCTTAAGGG TGG (reversed) Intronic
902878668 1:19356413-19356435 TGCTGGCCTCCTGCTGAGGGAGG - Intronic
909881427 1:80884199-80884221 TTCTCTCCTCCTTTTAAGGAAGG - Intergenic
910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG + Intergenic
914243805 1:145871522-145871544 TTCTCGCCTCCACTTCAGGGTGG - Intronic
915916147 1:159942080-159942102 TTGTTGCCTCCTCTTCAGAGGGG - Intronic
915979132 1:160409258-160409280 TTCTGGCCTCCTCTAATTGTTGG - Intronic
916600402 1:166287767-166287789 TTCTTGCTTCCTTTCAAGGGTGG + Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918018664 1:180663710-180663732 TTGTGTTCTTCTCTTAAGGGTGG + Intronic
919455978 1:197819490-197819512 TTCTGTTCTTCCCTTAAGGGTGG - Intergenic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG + Intronic
924204502 1:241697937-241697959 TTCATGCCTTCTCTTAATGGTGG + Intronic
924757318 1:246953141-246953163 TTCAGGCCTCCTTTGGAGGGAGG + Intronic
1067032666 10:42888812-42888834 TTCTTTCCTCCACTTAAGGAGGG - Intergenic
1067269726 10:44779897-44779919 TGCTGACCTCCTCCTACGGGAGG - Intergenic
1067430756 10:46242457-46242479 TTTTGGCCCCCTTTTTAGGGGGG - Intergenic
1070806749 10:79275281-79275303 TACTGTCCTCCTTTTGAGGGTGG + Intronic
1075348949 10:121706527-121706549 TTCTGACCTCCACTTTAGAGAGG - Intergenic
1075495442 10:122915378-122915400 TTCTGCCCTCCTGCTAATGGGGG - Intergenic
1076211246 10:128646717-128646739 ATCTGTCCTCCTCTGAAGGAAGG - Intergenic
1076408630 10:130230611-130230633 AGCTGGCCTCCACTGAAGGGAGG + Intergenic
1076705828 10:132301152-132301174 TTCTGGGCTCATATTAATGGAGG - Intronic
1078851816 11:15171200-15171222 CTCTGGCATCCTCTGAATGGAGG - Intronic
1079633355 11:22705845-22705867 TTAGGTCCTCCTCTTAAAGGAGG - Intronic
1083895036 11:65615814-65615836 TTCCGGCCTCCTCCTTAGGCCGG + Exonic
1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG + Intergenic
1085178532 11:74511699-74511721 TTGTGTCCTCCCCTTCAGGGTGG - Intronic
1086992164 11:93315259-93315281 TTCTGTCCTCCTCTTCAGTCTGG + Intergenic
1088413834 11:109567518-109567540 TGCTGGCCTTCTCTGCAGGGAGG - Intergenic
1090360016 11:126165640-126165662 TTGGGGCCTCCGCTGAAGGGAGG + Intergenic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1092477006 12:8828172-8828194 TTGTGTCCTCCCCTTCAGGGTGG + Intronic
1094261742 12:28508336-28508358 TTCTGGACTCCTCTTATGCTTGG + Intronic
1096085208 12:48861120-48861142 TTCTGTCCTCCACTGAGGGGTGG + Exonic
1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG + Intergenic
1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG + Intronic
1104710602 12:130982995-130983017 TTCTGGCTCATTCTTAAGGGAGG + Intronic
1107851866 13:44578233-44578255 TTCTGTCCTCCAGTTAAGGATGG - Intergenic
1108836637 13:54558118-54558140 TACTCTCCTCCTCTTAAGTGAGG + Intergenic
1110607212 13:77446859-77446881 TTCTAGCCTCATCCTAAGAGGGG - Intergenic
1117809577 14:59532578-59532600 TTCTGGCCTTCCCTTGTGGGTGG + Intronic
1118241082 14:64059742-64059764 TTGTGTCCTTCCCTTAAGGGTGG + Intronic
1118383685 14:65238148-65238170 TTCTGGCCTCCCTTGTAGGGAGG + Intergenic
1122936056 14:104956776-104956798 TTCTGGGCCCCTCTGAAGGGAGG - Intronic
1126852695 15:52806568-52806590 ATCTGGCCTTCTCTAGAGGGAGG - Intergenic
1127173563 15:56328860-56328882 GTCTGTCCTTCTCTTCAGGGTGG - Intronic
1127254993 15:57282469-57282491 TTCTTCCCTTCTCTTAAGGCAGG - Exonic
1130682233 15:86006755-86006777 TACTTACCTCCTCTTAAAGGGGG - Intergenic
1130989378 15:88866791-88866813 GTCTGGTCTGCTCTTATGGGAGG + Intronic
1133981465 16:10635958-10635980 TTCTGACCTCCTCTGACTGGGGG + Intronic
1134347801 16:13407385-13407407 TTAGGGCCTCTTTTTAAGGGCGG + Intergenic
1137739391 16:50752733-50752755 TTCTAGGCTCCTCATAAGAGTGG + Intronic
1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG + Intronic
1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG + Intronic
1140786744 16:78349496-78349518 TCCTGGCTTCTTCTAAAGGGTGG - Intronic
1142545664 17:700853-700875 TTCTGGCTACCTCTGATGGGAGG + Intronic
1142814007 17:2411263-2411285 TCCTTCCCACCTCTTAAGGGAGG - Intronic
1144710697 17:17399659-17399681 CTCTGGCCTCATCCTGAGGGAGG - Intergenic
1145979300 17:29002431-29002453 TCCTGGCCTCCTCAGCAGGGTGG - Intronic
1147337241 17:39734571-39734593 TCCTGGCCTCTTATTAATGGTGG + Intergenic
1147979014 17:44263291-44263313 TGCTGGTCTCTTCTTCAGGGGGG + Intronic
1150647163 17:66986148-66986170 TTCTGGCCTCCTCTCATAAGAGG - Intronic
1152029831 17:77835038-77835060 TCCAGGCCTCCAGTTAAGGGGGG - Intergenic
1153084425 18:1267792-1267814 TTCTGGCTTCCACTTAATGGAGG - Intergenic
1154491211 18:14923582-14923604 TTCTGTCCTTCCCTTCAGGGTGG - Intergenic
1155130987 18:22933960-22933982 TTCAGGGGTCCTCTTATGGGCGG - Exonic
1168521460 19:57054144-57054166 CTCTGTCTTCCACTTAAGGGAGG + Intergenic
935182198 2:100701247-100701269 CACTGGCCTCCCCTAAAGGGTGG + Intergenic
935451094 2:103210400-103210422 TTTTGACTTCTTCTTAAGGGTGG + Intergenic
936780444 2:116026561-116026583 TTCTGTCCTCCACATAAAGGTGG + Intergenic
938599782 2:132825381-132825403 TTTTGTCTTCCTCTTAGGGGTGG - Intronic
939273672 2:139971552-139971574 TTATGCCCTCCTCTCCAGGGTGG - Intergenic
945461643 2:210116332-210116354 TTGTGTCCTTCCCTTAAGGGTGG - Intronic
946157364 2:217815771-217815793 TTCTGCCCTCATCTTCATGGTGG - Intronic
946437234 2:219665376-219665398 TTCTGGCCTGTCCTTAAGAGGGG + Intergenic
948006265 2:234610333-234610355 TTCTGGGCTCCTCTAGAGGAAGG - Intergenic
1169514837 20:6304262-6304284 TACTGGCCTCCTACTAAAGGAGG - Intergenic
1169648674 20:7842788-7842810 TTATGGCCTACTTTCAAGGGAGG - Intergenic
1178083718 21:29092315-29092337 CTCTTGCCTCCTCTTTAGAGAGG - Intronic
1178275255 21:31231004-31231026 TTCTGGCCCCCTCTGAAGCCAGG + Intronic
1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG + Intergenic
1183125777 22:35780187-35780209 CTCTGGCCTTCTCTTTAGTGCGG + Intronic
1183341542 22:37284461-37284483 CTCTGGCCTCCTCCTCAAGGAGG - Intronic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
1185401887 22:50623242-50623264 TGTTGGCCTCCTCTGCAGGGAGG - Intronic
953470965 3:43165719-43165741 TTTTGGCCTGCTCTTTAGTGTGG - Intergenic
956881873 3:73519249-73519271 CTCTGGCCTCCTCTTTACGCTGG - Intronic
958702023 3:97604084-97604106 TTATAGCCTCCTCCTTAGGGTGG - Intronic
959654878 3:108791862-108791884 TTCTTGCCTCATCTAAAAGGAGG + Intergenic
966817069 3:183897985-183898007 TTCTGGCCTCCTTGCAAAGGAGG + Intergenic
967014976 3:185473523-185473545 TTCTGGCCTGCACTGAAGGCAGG - Exonic
969965780 4:10993913-10993935 TTCTGTCTTCCACTTAAGGATGG + Intergenic
971612100 4:28738658-28738680 TTGTGGACTTCACTTAAGGGAGG - Intergenic
976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG + Intronic
980859910 4:138486602-138486624 CTCTGCCCTCCTCTGAATGGTGG - Intergenic
981489615 4:145325615-145325637 TTCTGGACTCCACTTATGGTGGG + Intergenic
985696452 5:1343588-1343610 TTCTGGCCTCCCCTTCATGGAGG + Intronic
986514916 5:8551265-8551287 TTCTGGCCTCCTTGGAAGAGTGG - Intergenic
986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG + Intergenic
986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG + Intergenic
987172242 5:15270817-15270839 TTCTGCCATCCTGCTAAGGGAGG + Intergenic
988935588 5:36079407-36079429 TTCTGCCATCCTCATCAGGGAGG - Intergenic
991437476 5:66611437-66611459 TTCTGTCCTCCTCTCATGAGAGG + Intronic
997346009 5:133192697-133192719 GACTGGCCTCCCCTTAAGGAGGG + Intergenic
998745567 5:145255195-145255217 ATATGGCCTACTGTTAAGGGAGG + Intergenic
1001512886 5:172336297-172336319 ATGGGGCCTCCTCTCAAGGGAGG + Exonic
1001585061 5:172828196-172828218 CTCTGGCCTCGTCTTGAGGCAGG - Intergenic
1003456393 6:6286545-6286567 TTCTTGCCTCCTCATAAGGCAGG - Intronic
1006260700 6:32867055-32867077 TTCTGGTTTCCACTTTAGGGAGG - Intergenic
1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG + Intergenic
1008713010 6:54252625-54252647 CTCTGGCCTCCTCATAGGAGTGG + Intronic
1012455186 6:99395477-99395499 TATTGACCTCCTCCTAAGGGTGG + Intergenic
1012893077 6:104919191-104919213 TTCTGCCCTCATTTTGAGGGGGG - Intergenic
1013327466 6:109061918-109061940 TTCTGTCCTCCACTAAAGTGAGG - Intronic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1014688178 6:124529988-124530010 CTCTGGCCTCTTCTTATGAGAGG - Intronic
1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG + Intronic
1022503004 7:30894276-30894298 TGCTGGCCTCCTCTTTTGTGAGG + Intergenic
1024364417 7:48504791-48504813 TTCTGACCTCCTGATAAGGTTGG + Intronic
1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG + Intronic
1030517435 7:110555528-110555550 TAATGTCCTCCTCTTGAGGGTGG + Intergenic
1031376309 7:121030793-121030815 TTCAGGCATCCACTTGAGGGGGG + Intronic
1031753889 7:125613154-125613176 TTGTGTCCTTCTCTTCAGGGCGG - Intergenic
1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG + Intergenic
1036196184 8:6717055-6717077 TTCTGCCTTACTCTTGAGGGTGG - Intronic
1036760399 8:11504736-11504758 ATCAGGCCTCATCTCAAGGGTGG - Intronic
1038628429 8:29217171-29217193 TGCAGGCCTCCTCTACAGGGTGG - Intronic
1048910378 8:139129166-139129188 TTCTGGCAACCTCCTCAGGGAGG + Intergenic
1049156597 8:141070968-141070990 TCCTGGCCTCCGCGTCAGGGAGG - Intergenic
1049423206 8:142525901-142525923 TCCTGGCCTCCTCTGCTGGGGGG - Intronic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1050722052 9:8601321-8601343 TCCAGGCCTTCTTTTAAGGGTGG - Intronic
1051342737 9:16126953-16126975 TTCTGGTTTCATCTTAAGAGAGG - Intergenic
1053330982 9:37206777-37206799 TCCTGGCCACCTTGTAAGGGAGG - Intronic
1055904598 9:81278096-81278118 GTCTGTCTTCCTCTTAAGGAAGG + Intergenic
1061591312 9:131599520-131599542 GTCTGGCCTCGTCTAAAGGTCGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1189628256 X:42921980-42922002 TTGTGTCCTTCTCTTCAGGGTGG - Intergenic