ID: 1062043179

View in Genome Browser
Species Human (GRCh38)
Location 9:134413527-134413549
Sequence CCATTCTGGCCTCCTCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043179_1062043186 7 Left 1062043179 9:134413527-134413549 CCCTTAAGAGGAGGCCAGAATGG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1062043186 9:134413557-134413579 GAGTTCGGTCCTGCCTGTCTTGG No data
1062043179_1062043191 20 Left 1062043179 9:134413527-134413549 CCCTTAAGAGGAGGCCAGAATGG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1062043191 9:134413570-134413592 CCTGTCTTGGGCCCAGCCCTGGG No data
1062043179_1062043189 19 Left 1062043179 9:134413527-134413549 CCCTTAAGAGGAGGCCAGAATGG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1062043189 9:134413569-134413591 GCCTGTCTTGGGCCCAGCCCTGG No data
1062043179_1062043192 30 Left 1062043179 9:134413527-134413549 CCCTTAAGAGGAGGCCAGAATGG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1062043192 9:134413580-134413602 GCCCAGCCCTGGGCTGCACAAGG No data
1062043179_1062043187 8 Left 1062043179 9:134413527-134413549 CCCTTAAGAGGAGGCCAGAATGG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1062043187 9:134413558-134413580 AGTTCGGTCCTGCCTGTCTTGGG No data
1062043179_1062043185 -8 Left 1062043179 9:134413527-134413549 CCCTTAAGAGGAGGCCAGAATGG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043179 Original CRISPR CCATTCTGGCCTCCTCTTAA GGG (reversed) Intronic
900496677 1:2978927-2978949 TCACTCTGGCCTCCTCTGAGGGG + Intergenic
903031216 1:20465681-20465703 CCCTTCTCTCCTCATCTTAAAGG + Intergenic
904194910 1:28777935-28777957 CCATTCTGGGATCCTCTTCTGGG + Intergenic
906492633 1:46279946-46279968 CCATTTTGTCCACCTCTGAAAGG + Intronic
907137419 1:52153011-52153033 CCATGCAGGCCTCCTCTAACAGG - Intronic
908459885 1:64339002-64339024 CCATACTGGCCTCCTCTGTGAGG - Intergenic
915242947 1:154536936-154536958 CCATTCTGGCCTCCTCCAGTGGG - Intronic
915824813 1:159064333-159064355 CCACCCTGGCCTCCTCCTAAAGG - Intronic
921450711 1:215302508-215302530 CCATTTTGGGCTCCTCATAAAGG + Intergenic
923249449 1:232166558-232166580 CCATTCTTCCCTCTTCTGAATGG - Intergenic
1065640343 10:27776040-27776062 CAATTCTTGCCTCCTCAAAAGGG + Intergenic
1066583086 10:36901748-36901770 TCATAATGGCCTCATCTTAAGGG + Intergenic
1068639151 10:59382456-59382478 GCATTCTGGTCTCTTCTTATAGG - Intergenic
1074029847 10:109676282-109676304 CCATTCTGGTCAACTTTTAAGGG - Intergenic
1074469923 10:113717602-113717624 CCATTCTGGCATTTTCTGAAGGG + Intronic
1074714347 10:116204221-116204243 TCATTCTAGCCTCCTCTCACTGG - Intronic
1078043572 11:7892389-7892411 CCAATCTGGCCACCTCTGTAAGG + Intergenic
1084454811 11:69262334-69262356 CCATCCTGGGCTCCTCTCTAGGG + Intergenic
1085776963 11:79375753-79375775 GCCTTCAGGTCTCCTCTTAAAGG - Intronic
1086760221 11:90620766-90620788 CCATTCTGGCCATCTCTTTCAGG - Intergenic
1089275564 11:117333439-117333461 CCAATCTGGCCTCCGCTTTAGGG + Intronic
1090684669 11:129101738-129101760 CCATTCTCTCCACCTCTTTAAGG - Intronic
1090813668 11:130270894-130270916 CCATTCTGGCCTGCAGTTCAGGG + Intronic
1090934435 11:131329166-131329188 CCATGCTGGCCTGCCCTTACTGG - Intergenic
1098313879 12:69174055-69174077 CCTTTCTGGCCGCCTCTTGATGG + Intergenic
1100668976 12:96789098-96789120 CCAATCTGGCCTCATATTATTGG + Intronic
1100984654 12:100192419-100192441 CCACTCTGGCCTCTTCTATAAGG - Intergenic
1102599033 12:114014797-114014819 CCCTTCTGACCTCCTGTCAAAGG - Intergenic
1105645109 13:22309517-22309539 CAATTCTTGCCTTTTCTTAAAGG + Intergenic
1111280141 13:86011633-86011655 CCATTATTCCCTCCACTTAAAGG + Intergenic
1112803586 13:103138241-103138263 CCATTCAGGTCTCTACTTAAAGG - Intergenic
1114082629 14:19214489-19214511 TCATTCTGTCTTTCTCTTAAGGG - Intergenic
1124161356 15:27272649-27272671 CCATTCCAGCCACCTCTGAAGGG + Intronic
1129717505 15:77860703-77860725 CCACTCTGGCCCCCTCGTCATGG + Intergenic
1130429311 15:83830827-83830849 CCAGTCTGGCCTCCTGCAAATGG - Intronic
1130559783 15:84948925-84948947 CCATTCTGGGCCACTCTGAATGG + Intergenic
1131015408 15:89053654-89053676 CCATTCTCCCCTCCTCTCGAAGG - Intergenic
1131388184 15:92025057-92025079 CCATCCTTCCATCCTCTTAATGG + Intronic
1131494099 15:92889999-92890021 CACTTCTGCCCTTCTCTTAAGGG + Intronic
1133981461 16:10635955-10635977 CCCTTCTGACCTCCTCTGACTGG + Intronic
1135474947 16:22765724-22765746 CCATACAGTTCTCCTCTTAAAGG - Intergenic
1138420075 16:56893124-56893146 CCTTCCTGGCCTGCTCTCAAAGG + Intronic
1143903921 17:10195218-10195240 CCAAGCTGGCCTCCTCCCAAGGG + Intronic
1144080325 17:11758425-11758447 CCATTCTTGCCTCCACTACAGGG - Intronic
1145979301 17:29002434-29002456 CCATCCTGGCCTCCTCAGCAGGG - Intronic
1149552003 17:57547287-57547309 CCCTTCTGACCTCCTCCTGAGGG - Intronic
1151450562 17:74196024-74196046 CCACTCAGGCCTCCTCACAAGGG + Intergenic
1152318531 17:79594978-79595000 CCAGTCTGGTCTCCTCTTTGGGG - Intergenic
1156177901 18:34569045-34569067 CATTTCTGGCCTCCTGTTAAGGG - Intronic
1158751364 18:60265194-60265216 CTATTATGGCCTACTCTTAGTGG - Intergenic
1159607425 18:70489652-70489674 TCATTCTGGGCTCCTCTGTAGGG - Intergenic
1160593283 18:79956722-79956744 CCATCCTCTCCTCCTCTGAAGGG + Intergenic
1165247964 19:34508573-34508595 CCATCCTGGCCTCATCTCCAGGG - Exonic
1165831851 19:38734426-38734448 GCATTCTGGCCACCACTTTAAGG + Intronic
1167146110 19:47681419-47681441 CCCTTCGGGCCTCCTCTTAGGGG - Intronic
1168026733 19:53648529-53648551 CCAGCCTGGACCCCTCTTAATGG - Intergenic
1168026762 19:53648623-53648645 CCAGCCTGGACCCCTCTTAATGG - Intergenic
1168026777 19:53648670-53648692 CCAGCCTGGACCCCTCTTAATGG - Intergenic
1168026803 19:53648764-53648786 CCAGCCTGGACCCCTCTTAATGG - Intergenic
1168026832 19:53648858-53648880 CCAGCCTGGACCCCTCTTAATGG - Intergenic
1168026847 19:53648905-53648927 CCAGCCTGGACCCCTCTTAATGG - Intergenic
1168026873 19:53648999-53649021 CCAGCCTGGACCCCTCTTAATGG - Intergenic
1168026888 19:53649046-53649068 CCAGCCTGGACCCCTCTTAATGG - Intergenic
1168026899 19:53649093-53649115 CCAGCCTGGACCCCTCTTAACGG - Intergenic
925531500 2:4868134-4868156 CCATTCTAGCCAACTCTTAATGG + Intergenic
927943475 2:27120346-27120368 CCAGTATGACCTCATCTTAATGG - Intergenic
928315310 2:30240014-30240036 ACATCCCGGCCTCCTCTCAAGGG + Intronic
928381611 2:30822973-30822995 CCTTCCTGGCCACTTCTTAAAGG - Intergenic
931791191 2:65665760-65665782 CCAGCCTGGCACCCTCTTAAGGG - Intergenic
932726740 2:74186024-74186046 TCCTTCTGTCCTCCTCTTACAGG - Intergenic
932798217 2:74715859-74715881 GCCTTCTCTCCTCCTCTTAAAGG + Intergenic
938082377 2:128377012-128377034 CCAGCCTGGTCACCTCTTAAAGG + Intergenic
940287393 2:152046204-152046226 CCATTCTAGCCTCCCCTGAATGG - Intronic
941578504 2:167266193-167266215 CCAGTCTGCCCTCCTCCTGAAGG - Intergenic
942485228 2:176432205-176432227 CCATTCTGTCCTGCTTTTCATGG - Intergenic
943984043 2:194595838-194595860 CCATTCTTCCCTTTTCTTAATGG + Intergenic
945686443 2:212976217-212976239 CAATTCTGTCTACCTCTTAATGG + Intergenic
1168878730 20:1188030-1188052 TCATTCTAGCCTCCTCCTCAGGG - Intronic
1175469699 20:59218763-59218785 CCTCCTTGGCCTCCTCTTAATGG - Intronic
1177034069 21:16019870-16019892 CCAGTGGGGCCTCTTCTTAAAGG + Intergenic
1177607382 21:23398888-23398910 CCATGCTGGCCTCATCCTTATGG + Intergenic
1181431283 22:22883161-22883183 CCACTCTGACCCCCGCTTAAGGG - Intronic
1183088779 22:35506938-35506960 TGATTCTGTCCTCGTCTTAAAGG - Intergenic
949729896 3:7096667-7096689 CCATTCTGACCTCCTCAGAGGGG - Intronic
950334045 3:12179748-12179770 CAGTTCTGGCCACCTCTTAAGGG - Intronic
950910495 3:16584599-16584621 CCATTCTGGCTCAATCTTAATGG - Intergenic
953344256 3:42161797-42161819 CCTTTCTGGCCTTGTCTTGAAGG + Intronic
953920315 3:46947176-46947198 CCAGTTTGGCCTCTTCTTAGGGG - Intronic
954055705 3:48022553-48022575 CCATTTTAGCCTTCACTTAATGG - Intronic
955831340 3:63007460-63007482 CCATTCTGGGCTTGACTTAAAGG - Intergenic
956923329 3:73954163-73954185 CCATTATGTCCTCGTGTTAAAGG + Intergenic
960885674 3:122391701-122391723 CCATACTGGCCTTCTCTTTATGG + Intronic
965260684 3:166480776-166480798 CCATGCTTGTCTCTTCTTAAAGG - Intergenic
965315511 3:167184797-167184819 ACATTCTGGCCTACTTTTATGGG - Intergenic
966532004 3:180991542-180991564 TCCTTCTGGTTTCCTCTTAAAGG + Intergenic
967648879 3:191961242-191961264 GCATTCTTGTCTCCTTTTAACGG + Intergenic
967744391 3:193038897-193038919 CCATTTTGTACTCCTCTTACTGG + Intergenic
969224701 4:5787892-5787914 GCTTTCAGGCCTCCTCTTACTGG + Intronic
969237670 4:5877443-5877465 CCACTCTGGCCTCCTTGCAACGG + Intronic
971219729 4:24693747-24693769 CCATTCTGCCCTTTTCTGAATGG - Intergenic
972262819 4:37427638-37427660 CCATTCTAGCCCCTTCTAAAGGG + Intronic
972420716 4:38883770-38883792 CCTTTTTGGCCTGCTCTAAAAGG + Intronic
972658761 4:41093391-41093413 CAATTTTGGCTTCCTTTTAAGGG + Intronic
973742362 4:53930449-53930471 CTATTAGTGCCTCCTCTTAAAGG - Intronic
975057503 4:69952816-69952838 CCATGCTGGACTCGTCTTTAGGG + Intergenic
978171254 4:105672982-105673004 GCATTCAGGCCTCCTCTGAAGGG - Intronic
982440702 4:155432698-155432720 CCATTCTGGGCTTCTCTAAGAGG - Intergenic
983273081 4:165586347-165586369 GGGTTCTGTCCTCCTCTTAAAGG + Intergenic
983291809 4:165816612-165816634 CCATTTTGCCCACTTCTTAATGG - Intergenic
985696451 5:1343585-1343607 CACTTCTGGCCTCCCCTTCATGG + Intronic
985865984 5:2515043-2515065 TCATTCTGGCATCCTCGTCACGG + Intergenic
987382305 5:17296610-17296632 CACTTCTGGCCTTTTCTTAAAGG - Intergenic
989432440 5:41371598-41371620 CCCTTCTAGCATCCTCTTACTGG + Intronic
998091714 5:139374914-139374936 CCAGTCTAGCATCCTCTAAATGG + Intronic
1003184798 6:3821356-3821378 CCATTCTGGCCCCGGCTTCACGG - Intergenic
1004313000 6:14562418-14562440 CCAATATGGCCTCCTGTAAAAGG + Intergenic
1006896032 6:37471750-37471772 TCATTCAGGCCTCCTCTCTATGG + Intronic
1012646974 6:101697196-101697218 ATATTATTGCCTCCTCTTAAAGG + Intronic
1016726614 6:147377662-147377684 CCTCTCTGGCCTCTTTTTAAGGG + Intronic
1017415854 6:154219886-154219908 CCATTCTGTCCTCATCTGGAGGG + Intronic
1018298214 6:162372077-162372099 TCCTTCTGGCCTCCTCCTGAAGG + Intronic
1018885929 6:167937178-167937200 GCATTCGGGCCTCCACTTCACGG - Intronic
1021202423 7:17741591-17741613 ACAGTCTGGCCACCTCTTAGTGG - Intergenic
1028519692 7:91716384-91716406 CCTTTCTGGCATCCTCATTATGG + Intronic
1030161313 7:106511135-106511157 CCATTGTAGCCTCCTGTTTACGG - Intergenic
1032401688 7:131628720-131628742 CCATTCTGGCCTCCAGTTCAGGG + Intergenic
1032887238 7:136153907-136153929 CCATTCTGGTCTCAGCTCAATGG - Intergenic
1034130544 7:148712048-148712070 CCATTCTGCCCTCCTTTTAGAGG - Intronic
1034827141 7:154275772-154275794 CCACTCTCTCCTCCTCTTGAGGG - Intronic
1034892760 7:154855336-154855358 CCATTCTGACATCCACTTTATGG - Intronic
1037074854 8:14701966-14701988 TAATTATGTCCTCCTCTTAAAGG + Intronic
1037117039 8:15239121-15239143 CCATTCTTGCCCCCTCGTTAAGG + Intergenic
1037604068 8:20422675-20422697 CCTTTCTGCCCTCGTCTCAACGG + Intergenic
1038954128 8:32448832-32448854 CTATTCTGGCTTCTTCTTAAAGG + Intronic
1040775655 8:51040043-51040065 GCATTCTGGGCCCCTCTTAGGGG + Intergenic
1042659543 8:71139061-71139083 CCATCCAGGCAGCCTCTTAATGG + Intergenic
1042770406 8:72374670-72374692 CCATTCTGGCCTGCTTTTGCTGG + Intergenic
1043800673 8:84605819-84605841 GGATTCTGACCTCCTCTGAAAGG + Intronic
1048984004 8:139721208-139721230 CCATTCTCTCCTCCTCCTATGGG + Intergenic
1050722053 9:8601324-8601346 CCATCCAGGCCTTCTTTTAAGGG - Intronic
1052461592 9:28771070-28771092 ACCTACTGGTCTCCTCTTAAAGG + Intergenic
1055770083 9:79707654-79707676 GCCTTCTGGCCTTCTTTTAATGG + Intronic
1057700752 9:97361782-97361804 CCAGCTTGGCCTCCTCTTCAAGG - Exonic
1061590212 9:131593211-131593233 CCATGCCTGCCTCCTCTTAGAGG + Intronic
1062043179 9:134413527-134413549 CCATTCTGGCCTCCTCTTAAGGG - Intronic
1062340315 9:136091141-136091163 CCATGGCGGCCTCCTCTTAAAGG + Intronic
1186093994 X:6080417-6080439 CCATTCTCGCCTACTCATAAAGG + Intronic
1187455923 X:19441266-19441288 CCATTTTGGCAACCTGTTAATGG - Intronic
1189716808 X:43875465-43875487 CCATTATGGCCTCCTCTTAGGGG + Intronic
1190680227 X:52820375-52820397 CCAATGTGGCCTCCCATTAAGGG - Intergenic
1196928177 X:120654918-120654940 ACTTTCTGGCCTCTTCTTCAGGG + Intergenic
1196970939 X:121107814-121107836 TCAATCTGGGCTCCTCTTAGGGG + Intergenic
1199258142 X:145740711-145740733 TCATCCTGGCCTCTTCTCAAAGG + Intergenic
1202246115 Y:22822096-22822118 CCATTGTGTCCACCTCTTAGGGG + Intergenic
1202399103 Y:24455844-24455866 CCATTGTGTCCACCTCTTAGGGG + Intergenic
1202471677 Y:25214242-25214264 CCATTGTGTCCACCTCTTAGGGG - Intergenic