ID: 1062043181

View in Genome Browser
Species Human (GRCh38)
Location 9:134413528-134413550
Sequence ACCATTCTGGCCTCCTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043181_1062043191 19 Left 1062043181 9:134413528-134413550 CCTTAAGAGGAGGCCAGAATGGT 0: 1
1: 1
2: 1
3: 18
4: 125
Right 1062043191 9:134413570-134413592 CCTGTCTTGGGCCCAGCCCTGGG No data
1062043181_1062043186 6 Left 1062043181 9:134413528-134413550 CCTTAAGAGGAGGCCAGAATGGT 0: 1
1: 1
2: 1
3: 18
4: 125
Right 1062043186 9:134413557-134413579 GAGTTCGGTCCTGCCTGTCTTGG No data
1062043181_1062043189 18 Left 1062043181 9:134413528-134413550 CCTTAAGAGGAGGCCAGAATGGT 0: 1
1: 1
2: 1
3: 18
4: 125
Right 1062043189 9:134413569-134413591 GCCTGTCTTGGGCCCAGCCCTGG No data
1062043181_1062043187 7 Left 1062043181 9:134413528-134413550 CCTTAAGAGGAGGCCAGAATGGT 0: 1
1: 1
2: 1
3: 18
4: 125
Right 1062043187 9:134413558-134413580 AGTTCGGTCCTGCCTGTCTTGGG No data
1062043181_1062043185 -9 Left 1062043181 9:134413528-134413550 CCTTAAGAGGAGGCCAGAATGGT 0: 1
1: 1
2: 1
3: 18
4: 125
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043181_1062043192 29 Left 1062043181 9:134413528-134413550 CCTTAAGAGGAGGCCAGAATGGT 0: 1
1: 1
2: 1
3: 18
4: 125
Right 1062043192 9:134413580-134413602 GCCCAGCCCTGGGCTGCACAAGG No data
1062043181_1062043194 30 Left 1062043181 9:134413528-134413550 CCTTAAGAGGAGGCCAGAATGGT 0: 1
1: 1
2: 1
3: 18
4: 125
Right 1062043194 9:134413581-134413603 CCCAGCCCTGGGCTGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043181 Original CRISPR ACCATTCTGGCCTCCTCTTA AGG (reversed) Intronic
900323742 1:2097329-2097351 ACCTTTCTGGGCCCCTCTCAGGG + Intronic
900496676 1:2978926-2978948 CTCACTCTGGCCTCCTCTGAGGG + Intergenic
904194908 1:28777934-28777956 GCCATTCTGGGATCCTCTTCTGG + Intergenic
904675218 1:32195054-32195076 GCCCCTCTGGCCTCCTCTCAGGG - Exonic
908791571 1:67787750-67787772 ATAATTCTGCCGTCCTCTTAGGG - Intronic
909395625 1:75168174-75168196 ACCATTCTGGCCCACTTTGAAGG - Intergenic
910781542 1:90941075-90941097 ACTAGACTGGCCTCCACTTAAGG + Exonic
915242949 1:154536937-154536959 TCCATTCTGGCCTCCTCCAGTGG - Intronic
918823378 1:189288704-189288726 ATCATTCTTGCCTCAACTTACGG + Intergenic
919657789 1:200214341-200214363 ACCATCCTGGGCTTCTCTTTGGG - Intergenic
922614636 1:226954528-226954550 AGCACTCTGGACTCGTCTTAAGG + Intronic
922774162 1:228207324-228207346 TCCATCCTGGGCTCCTCTTGGGG + Intronic
923641772 1:235769333-235769355 ACCATTCTAGCTTCATCTTATGG - Intronic
924295096 1:242578459-242578481 ACCATTCTGGGCTCTTCATAAGG - Intergenic
1063749605 10:8927958-8927980 CCCATTCTGGCCTCACCTAAGGG - Intergenic
1067371155 10:45683534-45683556 ATTATTCTGGCCTCTTTTTAGGG + Intergenic
1067388627 10:45842618-45842640 ATTATTCTGGCCTCTTTTTAGGG - Intronic
1067417438 10:46114339-46114361 ATTATTCTGGCCTCTTTTTAGGG + Intergenic
1067502852 10:46821222-46821244 ATTATTCTGGCCTCTTTTTAGGG + Intergenic
1067909474 10:50331674-50331696 ACCACTCTTGCCTCCTGCTATGG + Intronic
1070135840 10:73693019-73693041 ATTATTCTGGCCTCTTTTTAGGG - Intronic
1071966024 10:90853802-90853824 ACCATTCTTGCTTCTTCTTAGGG + Intronic
1072594041 10:96854962-96854984 TCCTTTCTCTCCTCCTCTTATGG + Intronic
1078261335 11:9711953-9711975 ACCATGCTTGCCTCCACTTCGGG + Intronic
1079704570 11:23598160-23598182 ACCATTCTGGCCTTCATTTCAGG - Intergenic
1080788720 11:35499920-35499942 ACCATCCTGCCTCCCTCTTACGG - Intronic
1081938533 11:46921099-46921121 CCCATTCTGGCCTGCTTTTCAGG - Intergenic
1086845212 11:91741282-91741304 ACCAATCTGTCAACCTCTTATGG + Intergenic
1089275562 11:117333438-117333460 TCCAATCTGGCCTCCGCTTTAGG + Intronic
1090279241 11:125442034-125442056 ACCATTCTCTCATCCTCTCAAGG + Intergenic
1094491498 12:30963694-30963716 ACCATTCTCGCCTCCTTTGGAGG + Intronic
1095564757 12:43609855-43609877 ACCTTTCTTGCTTCCTCTTGTGG - Intergenic
1100091013 12:90970918-90970940 GGCTTTCTTGCCTCCTCTTATGG - Intronic
1101403710 12:104410225-104410247 TCCATTCTGGCTTCATCTTTAGG - Intergenic
1105327463 13:19383130-19383152 ACCATCCTGGGCTTCTCTTTGGG - Intergenic
1105602589 13:21900513-21900535 ACCAGCCTGGCTTTCTCTTAAGG + Intergenic
1106443506 13:29801719-29801741 GACAGTCTGGCCTCTTCTTAGGG - Intronic
1107698971 13:43027986-43028008 AACATTCTAGCCTCCCATTATGG - Intronic
1109474917 13:62867610-62867632 ATCATTCTAGCCTCCTCTCATGG - Intergenic
1116747892 14:48845134-48845156 ACCATTCTTCCCTGCTTTTAAGG + Intergenic
1120825006 14:88946791-88946813 AGCATTCTGTCCTCCTCTCTGGG + Intergenic
1121775200 14:96585920-96585942 ACCATTGAGGCCTCCTCTTCAGG + Intergenic
1124161354 15:27272648-27272670 ACCATTCCAGCCACCTCTGAAGG + Intronic
1128086205 15:64888455-64888477 TCCATGATGGCCTCCTCTTCTGG + Intronic
1130744708 15:86638648-86638670 GTCCTCCTGGCCTCCTCTTAAGG - Intronic
1133444407 16:5847765-5847787 AACATTATAGCCACCTCTTAGGG + Intergenic
1137669723 16:50272092-50272114 CCCATTCTTGCCTCCTCCCAGGG + Intronic
1138572616 16:57885200-57885222 ACCATCCTGGCCTCCTCTGGGGG - Intronic
1143617651 17:8063485-8063507 ACCATTCTGGATTCCTTTTAGGG - Intergenic
1147323727 17:39660532-39660554 CCCAGTCTGGCTGCCTCTTAAGG + Intronic
1149623624 17:58064326-58064348 CCCATTCTGGCTTCCTCCCAAGG - Intergenic
1149907022 17:60535852-60535874 AACATTCTTGCCTCCACTTTTGG - Intergenic
1151450560 17:74196023-74196045 ACCACTCAGGCCTCCTCACAAGG + Intergenic
1151451456 17:74200655-74200677 CCCACTCTGGCCACCTCTGAAGG - Intergenic
1152318533 17:79594979-79595001 TCCAGTCTGGTCTCCTCTTTGGG - Intergenic
1153172539 18:2332767-2332789 ATCATGCTGGCCTCTTCCTAGGG - Intergenic
1155788946 18:29938763-29938785 ACCATTCTTGTTTCCTCTTTTGG - Intergenic
1156177902 18:34569046-34569068 GCATTTCTGGCCTCCTGTTAAGG - Intronic
1156602849 18:38630734-38630756 ACAATTCTAGCCTCCTTCTATGG + Intergenic
1157644763 18:49256325-49256347 ATCACTCTGACCTCCTCTTGTGG - Intronic
1158791442 18:60784774-60784796 ACCATTCTGGGGTCCACTGATGG - Intergenic
1159607426 18:70489653-70489675 ATCATTCTGGGCTCCTCTGTAGG - Intergenic
1162405140 19:10468694-10468716 ACCATTATTGCTTCCTCCTAGGG - Exonic
1164576434 19:29408004-29408026 CCCATTCTGCCATCCTCTTATGG - Intergenic
1164791608 19:30990135-30990157 AACATTCTGGACCCCTCTCAGGG + Intergenic
1166748108 19:45151560-45151582 ACCATGCTGGCCTCCTCATCTGG - Exonic
1167146112 19:47681420-47681442 ACCCTTCGGGCCTCCTCTTAGGG - Intronic
927267106 2:21163159-21163181 ACCATATTAGCCTCCTCTAATGG + Intergenic
927753073 2:25687063-25687085 TCCATTCTGGGCTCCTTTTGGGG + Intergenic
929141305 2:38669001-38669023 ACCATTCTGACCTCTGGTTATGG - Intronic
933229381 2:79788595-79788617 ACCACTCTGGAGTCCTCTCACGG - Intronic
934895871 2:98119069-98119091 ACCTTCCTGGCTTCCTCTAAAGG - Intronic
938923060 2:136012962-136012984 ACCATTCTGGTCTCCCCTCTCGG - Intergenic
938944515 2:136199603-136199625 ACCACTCTGGCCACCTCATCCGG + Intergenic
939316191 2:140552708-140552730 ACCATTATGGCATAATCTTAAGG + Intronic
942915818 2:181305274-181305296 CCCAGTTTGGACTCCTCTTAGGG - Intergenic
945903617 2:215566427-215566449 ACTATTCTGGCCTTCTATTTTGG - Intergenic
948501971 2:238401898-238401920 ACCACTGTGGGCTCCTCTGAGGG + Intergenic
948752165 2:240139165-240139187 ACCATTCAGTCCTCCTGATAGGG + Exonic
1168878731 20:1188031-1188053 ATCATTCTAGCCTCCTCCTCAGG - Intronic
1175146749 20:56902468-56902490 ATCATTCTCGCCTACTGTTATGG - Intergenic
1175553078 20:59829377-59829399 ATCATCCAGGCCTCATCTTATGG + Intronic
949729898 3:7096668-7096690 GCCATTCTGACCTCCTCAGAGGG - Intronic
950334046 3:12179749-12179771 CCAGTTCTGGCCACCTCTTAAGG - Intronic
950890777 3:16401944-16401966 ACCATTCTTGCCTGCTCTCAGGG + Intronic
951401805 3:22241677-22241699 AGCATTCTTGCCTCCTCTCCAGG - Intronic
953920317 3:46947177-46947199 GCCAGTTTGGCCTCTTCTTAGGG - Intronic
953960701 3:47263693-47263715 CCCATCCTGGCCTCCTCTGAAGG + Intronic
954178433 3:48862516-48862538 ACCTTTCAGGCCTCCACTTGAGG - Intronic
956863569 3:73348025-73348047 TCCATTCTAGCCTCTTGTTATGG - Intergenic
960089040 3:113620558-113620580 TTGATTCTGGCCTCCTCTGAAGG - Intronic
961091650 3:124118048-124118070 ATCCATCTTGCCTCCTCTTAGGG + Intronic
961436872 3:126925241-126925263 ACCATTCTGGTCTCTCCTTCTGG - Intronic
961509936 3:127394577-127394599 ACCATTTTTGCCACCTCTTTGGG + Intergenic
962587731 3:136859621-136859643 ACCATGCTGGCACCCTCTTTTGG - Intergenic
962925168 3:139986513-139986535 ACCCTTCTGCCCTCTTCTTGTGG + Intronic
964080280 3:152745931-152745953 ACTATCCTTGCCTCCTCTTGTGG - Intergenic
965315512 3:167184798-167184820 CACATTCTGGCCTACTTTTATGG - Intergenic
967715702 3:192758954-192758976 AACAGTCAGGCCTCCTCTTCAGG - Intronic
971263361 4:25076763-25076785 ACAATTGTGTCCTCCTCATAGGG + Intergenic
972658760 4:41093390-41093412 ACAATTTTGGCTTCCTTTTAAGG + Intronic
978135821 4:105258003-105258025 ACCAATCTGGCCTCCTCTAGTGG + Intronic
978171255 4:105672983-105673005 TGCATTCAGGCCTCCTCTGAAGG - Intronic
986273281 5:6252571-6252593 AACATTCTGGCCTCTCCTTGAGG - Intergenic
987378599 5:17261860-17261882 ACCATTGTGGCTTTCTCTTCTGG + Intronic
993490196 5:88537593-88537615 ACCATTCTGTCCTTCTTTCATGG - Intergenic
1002546222 5:179947142-179947164 ACCATTCTTGCCTCCTGGTTTGG + Intronic
1003456394 6:6286549-6286571 TCAATTCTTGCCTCCTCATAAGG - Intronic
1007726542 6:43920142-43920164 AGCATTCTTGCCTGCTCTTCTGG - Intergenic
1010184343 6:73125527-73125549 CCCACACTGGCCTCCACTTAGGG - Intronic
1016462666 6:144294321-144294343 CCCAATCTGGCTTCCTCTAAGGG + Intronic
1016726612 6:147377661-147377683 ACCTCTCTGGCCTCTTTTTAAGG + Intronic
1021114950 7:16737035-16737057 ACTATTCAGGACTCCTCTTATGG + Intergenic
1029336836 7:99907748-99907770 AACATTCTGTTCTACTCTTAAGG - Intronic
1029595966 7:101537823-101537845 ACCATCCCTGCCTCCTCTCATGG + Intronic
1030652865 7:112134028-112134050 ATCATTCTGGCCTCCTACCATGG - Intronic
1032401686 7:131628719-131628741 CCCATTCTGGCCTCCAGTTCAGG + Intergenic
1032432959 7:131877922-131877944 ACCATTCTGGAATCAGCTTATGG - Intergenic
1033106001 7:138524027-138524049 ACCAATTTGGCCTCATCTTAGGG + Intronic
1034827143 7:154275773-154275795 ACCACTCTCTCCTCCTCTTGAGG - Intronic
1039221079 8:35331462-35331484 ACAACTCTGGCCTCCTCCTTTGG - Intronic
1040775654 8:51040042-51040064 GGCATTCTGGGCCCCTCTTAGGG + Intergenic
1041336818 8:56794741-56794763 AGCAGTCTGGCCTTCCCTTAGGG + Intergenic
1043683239 8:83058002-83058024 TCCATTCTTGCCTTCTCATAAGG + Intergenic
1044583421 8:93845251-93845273 CTCATCCTGGCCTGCTCTTACGG + Intergenic
1045894038 8:107192848-107192870 ACTATTCCTGCCTCCTCCTATGG + Intergenic
1048305335 8:133279964-133279986 ACCGTTCTGGCCAGCTCTTTGGG + Intronic
1048644652 8:136406395-136406417 GCCTTTCTGGCCTCCTCTCATGG - Intergenic
1048984002 8:139721207-139721229 CCCATTCTCTCCTCCTCCTATGG + Intergenic
1055904597 9:81278092-81278114 AACAGTCTGTCTTCCTCTTAAGG + Intergenic
1057288958 9:93788205-93788227 ACCACTCTGGCCACCACTGATGG + Intergenic
1060166933 9:121425155-121425177 ATCATTCCTGCCTCATCTTATGG + Intergenic
1062043181 9:134413528-134413550 ACCATTCTGGCCTCCTCTTAAGG - Intronic
1185868241 X:3641542-3641564 AACATTCTGGGCTGCTCTGAAGG - Intronic
1188047000 X:25437389-25437411 ACAATTCTGGCCATCTCCTACGG - Intergenic
1189716806 X:43875464-43875486 ACCATTATGGCCTCCTCTTAGGG + Intronic
1190320664 X:49177537-49177559 ACCAGCCAGGCCTCCTCTTCAGG - Intronic
1196928176 X:120654917-120654939 AACTTTCTGGCCTCTTCTTCAGG + Intergenic
1196970938 X:121107813-121107835 GTCAATCTGGGCTCCTCTTAGGG + Intergenic
1198848687 X:140941571-140941593 ACCACTCTGACCTCCTCATCTGG + Intergenic
1199618879 X:149681509-149681531 ACCATTGTTGCCTCCAGTTAGGG + Intergenic
1200082950 X:153588324-153588346 ACCATCCTGGGCTTCTCTTTGGG + Exonic
1200795961 Y:7341522-7341544 AACATTCTGGGCTGCTCTGAAGG + Intergenic
1202246113 Y:22822095-22822117 ACCATTGTGTCCACCTCTTAGGG + Intergenic
1202399101 Y:24455843-24455865 ACCATTGTGTCCACCTCTTAGGG + Intergenic
1202471679 Y:25214243-25214265 ACCATTGTGTCCACCTCTTAGGG - Intergenic