ID: 1062043184

View in Genome Browser
Species Human (GRCh38)
Location 9:134413541-134413563
Sequence CGAACTCCACCAAACCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043184_1062043196 21 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043196 9:134413585-134413607 GCCCTGGGCTGCACAAGGGACGG No data
1062043184_1062043191 6 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043191 9:134413570-134413592 CCTGTCTTGGGCCCAGCCCTGGG No data
1062043184_1062043189 5 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043189 9:134413569-134413591 GCCTGTCTTGGGCCCAGCCCTGG No data
1062043184_1062043200 28 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043200 9:134413592-134413614 GCTGCACAAGGGACGGAGGAAGG No data
1062043184_1062043186 -7 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043186 9:134413557-134413579 GAGTTCGGTCCTGCCTGTCTTGG No data
1062043184_1062043194 17 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043194 9:134413581-134413603 CCCAGCCCTGGGCTGCACAAGGG No data
1062043184_1062043187 -6 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043187 9:134413558-134413580 AGTTCGGTCCTGCCTGTCTTGGG No data
1062043184_1062043192 16 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043192 9:134413580-134413602 GCCCAGCCCTGGGCTGCACAAGG No data
1062043184_1062043199 24 Left 1062043184 9:134413541-134413563 CCAGAATGGTTTGGTGGAGTTCG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1062043199 9:134413588-134413610 CTGGGCTGCACAAGGGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043184 Original CRISPR CGAACTCCACCAAACCATTC TGG (reversed) Intronic
900899634 1:5507895-5507917 AGGACGGCACCAAACCATTCAGG - Intergenic
917419738 1:174850284-174850306 AGAATTCTACCAAACCTTTCAGG + Intronic
918898657 1:190382857-190382879 TGAACCACACCAAACCAATCCGG + Intronic
1065153933 10:22850638-22850660 CTAACTGCACCAGACCAATCTGG + Intergenic
1066480409 10:35789804-35789826 GGAAATGCACCAAGCCATTCAGG - Intergenic
1067513692 10:46917686-46917708 TGAACTCTACCAAACCTTTAAGG - Intronic
1067648561 10:48134148-48134170 TGAACTCTACCAAACCTTTAAGG + Intergenic
1068667311 10:59690591-59690613 CCAACTCCACCAAACCTATCGGG - Intronic
1069143705 10:64861987-64862009 AGAAAACCACCAATCCATTCTGG + Intergenic
1073455041 10:103631653-103631675 CGGAGCCCACCAAGCCATTCTGG + Intronic
1075025748 10:118981994-118982016 CGAACTCCAACAAACCACACAGG + Intergenic
1078716624 11:13846091-13846113 AGAACTGTACCAAACCATCCAGG - Intergenic
1078725768 11:13929643-13929665 CCAACTCCACCAAATTATTGAGG - Intergenic
1081513740 11:43803975-43803997 CAAAGTCCTCCAAACCAATCTGG - Intronic
1091315010 11:134608442-134608464 CAAACACCAGCAAACCAGTCGGG - Intergenic
1091898690 12:4124896-4124918 AGGACACCACCAAACCATTGAGG + Intergenic
1097718207 12:62990312-62990334 TGAATTCCACCAAACCTTTAAGG - Intergenic
1102262780 12:111454891-111454913 CTGACTCCACCAAACCACGCTGG + Intronic
1102890861 12:116557672-116557694 AGGACTCCACCAAACCAGCCTGG - Intergenic
1114096410 14:19340518-19340540 CGCACTCCACAAAACCATCAAGG - Intergenic
1114888200 14:26881290-26881312 GTAACTGCACCAAACCAATCTGG - Intergenic
1115471820 14:33775803-33775825 CCAACTCCAGCGAATCATTCTGG - Intronic
1120827979 14:88972344-88972366 CGTACTACACAATACCATTCAGG + Intergenic
1124119250 15:26875164-26875186 CTAAGTGCACCAAGCCATTCTGG + Intronic
1124383877 15:29190228-29190250 GGAACTCCACCACACCACACAGG - Intronic
1126316958 15:47380255-47380277 CGAACTCAAAGAAAACATTCTGG - Intronic
1129500348 15:76030797-76030819 TGAATTCCACCAAACATTTCAGG + Intronic
1137613485 16:49834404-49834426 GGAACTCCACCAACCCTCTCTGG - Intronic
1139276135 16:65729208-65729230 CCACCTCGACCAAACCATGCTGG - Intergenic
1145096546 17:20033694-20033716 AGAATGGCACCAAACCATTCAGG + Intronic
1148884883 17:50765362-50765384 AAAACACCACCAAGCCATTCTGG + Intergenic
1153426464 18:4970331-4970353 AGAACTGTACCAAACAATTCAGG + Intergenic
925233228 2:2254313-2254335 CGAACTCCATCAATCCATGAAGG + Intronic
926337732 2:11876828-11876850 AGAACTTCTCTAAACCATTCAGG + Intergenic
933281650 2:80338387-80338409 GGAACTCCAGAAAACCATTTTGG + Intronic
939004340 2:136767702-136767724 TGAACACCTACAAACCATTCAGG + Intronic
940225416 2:151396052-151396074 CTAACTCCACCAGACCAGTCAGG - Intergenic
1170451157 20:16485257-16485279 AGAAATCCACCAAACCAGGCTGG + Intronic
1171822041 20:29858502-29858524 AAAACTACACAAAACCATTCTGG + Intergenic
1174287057 20:49481282-49481304 CAAGCTGCACCAAACCATTCTGG + Intronic
1183562570 22:38587634-38587656 TGAATTCTACCAAACCATTAAGG + Intronic
1184172818 22:42769549-42769571 CGGCCCCCACCAAGCCATTCAGG - Intergenic
955159299 3:56448457-56448479 AGAATTCCACCAAAACATTGTGG + Intronic
955252484 3:57298177-57298199 AGAACTCCACCTAGCCATGCAGG + Intronic
961822354 3:129581614-129581636 AGATCCCCACCAAACCCTTCAGG + Intronic
970323337 4:14897376-14897398 TGAGCTCCACCAATCCATGCTGG - Intergenic
977941399 4:102863412-102863434 AGGACTATACCAAACCATTCAGG + Intronic
985274387 4:188223742-188223764 GAAAGTCCACCAAAGCATTCTGG + Intergenic
986828359 5:11546673-11546695 CGAACAACACAAAACCTTTCTGG + Intronic
996383287 5:122884374-122884396 CGCATTCCACCCAACTATTCGGG - Intronic
997960546 5:138317289-138317311 CTAACTCCACTATACCATACTGG + Intronic
1013550934 6:111207239-111207261 GGAACTCCACCAAACCAGAATGG + Intronic
1014364656 6:120524259-120524281 CGAACTAGGCAAAACCATTCTGG - Intergenic
1022767252 7:33427318-33427340 CCTACTCCACCCAACCCTTCAGG - Intronic
1028474102 7:91234958-91234980 AGAACTCCAACAAACCATCATGG + Intergenic
1035038279 7:155909373-155909395 AGAACTGCACTAAACCATTTGGG + Intergenic
1036685747 8:10908803-10908825 TTAACTGCACCAATCCATTCAGG - Intronic
1038296238 8:26292514-26292536 CTAACTCTACCAAACCCTTTTGG - Intronic
1039271949 8:35891842-35891864 CCAACTCCTTCAAACCATTCTGG - Intergenic
1043820246 8:84854525-84854547 CCTACTCCCCCAAAGCATTCCGG + Intronic
1062043184 9:134413541-134413563 CGAACTCCACCAAACCATTCTGG - Intronic