ID: 1062043185

View in Genome Browser
Species Human (GRCh38)
Location 9:134413542-134413564
Sequence CAGAATGGTTTGGTGGAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043178_1062043185 -5 Left 1062043178 9:134413524-134413546 CCACCCTTAAGAGGAGGCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043173_1062043185 27 Left 1062043173 9:134413492-134413514 CCTCTGGCGCTGCTCTCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 244
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043181_1062043185 -9 Left 1062043181 9:134413528-134413550 CCTTAAGAGGAGGCCAGAATGGT 0: 1
1: 1
2: 1
3: 18
4: 125
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043179_1062043185 -8 Left 1062043179 9:134413527-134413549 CCCTTAAGAGGAGGCCAGAATGG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043176_1062043185 -3 Left 1062043176 9:134413522-134413544 CCCCACCCTTAAGAGGAGGCCAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data
1062043177_1062043185 -4 Left 1062043177 9:134413523-134413545 CCCACCCTTAAGAGGAGGCCAGA 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1062043185 9:134413542-134413564 CAGAATGGTTTGGTGGAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043185 Original CRISPR CAGAATGGTTTGGTGGAGTT CGG Intronic
No off target data available for this crispr